SimpleSearch - Line and FST details


Line specific information

 
Line ID 044C07
Vector Used pAC161
Line Availability only available from NASC (N404159)
Segregation Analysis 100:100:78
Confirmed for Hit At1g77145
Parent of DUPLO pair none
Parent of pair(s) 12537
Note Although the line exists, the insertion in At1g09770 can not be ordered because the confirmation of this insertion failed.
Although the line exists, the insertion in At1g65620 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g09770

 
Sequence (A. th genome BLAST matches underlined)
>51-K015474-022-044-C07-8409
TGATCCATGTATCGCTATGGGAATATGTTGGCAATGGTTGAAAAAGAGAGGAGATAATGG
TCGGTTTCCGACACAGGCATTGAAGAAACAAGAGGATGTTGAAGATTCTCACGAACTGAA
AGAAGCTAAGCTATGGGATCCTCCCTATAGTGAGAANCAANAGGATGGTGA
GenBank Accession AL763946 [GenBank]
Graphic View Graphic view of gene At1g09770
Predicted Position of Insertion Chr1:3164948 - go to primer design
BLAST e Value 7e-52
Hit Clone Code (BAC ID) F21M12
Hit Gene Code At1g09770 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cell division cycle 5
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 278B09

Gene hit At1g65620

 
Sequence (A. th genome BLAST matches underlined)
>51-K015601-022-044-C07-8409
AAATTTGATCCATGATAGCTTTCCTTGGACATGAAGCCTTTACAATTGAATATATCCTGA
CAAATCACCAGAGAAAGTTAGCTTCTTTTACCCTTTCTCTTACCAATTTTGGATTTTTCG
AAATTGGGTTTTTGATTAGATCATTAGACTCTGTTATAGGGTTTGTCTGGAAGCTTCTGG
TCCCTATGGGATCCTCCCATCAGTGAGAAAAATTCGTTTTTGTTCACAAAGTGTTTGGAG
CAAGTAACGCGACAAAGCTCCTCAACGAGCTTCACCCTTCACAACGTGAAGACGCAGTGA
ACTCTTTGGCCTATGAAGCCGACATGCGCCTCCGTGACCCTGTCTACGGCTGCGTCGGCG
TCATCTCTCTCCTCCAACATCAGCTTCGTCAGCTTCAGATAGATCTCAGCTGTGCTAAAT
CTGAGCTCTCTAAGTACCAAAGCCTCGGTATCCTCGCCGCCACTCATCAGAGTCTTGGCA
TCAACTTACTCGCCGGAGCAGCAGATGGAACAGCCACCGCCGTGAGAGACCACTATCACC
ACCACCAGTTTTTTCCTATGGGATCCTC
GenBank Accession AL763947 [GenBank]
Graphic View Graphic view of gene At1g65620
Predicted Position of Insertion Chr1:24400103 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F5I14
Hit Gene Code At1g65620 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Lateral organ boundaries (LOB) domain family protein
Insertion Classification TS2TE (5')
Confirmation Status failed, line belongs to a contamination group, please check line 283F11

Gene hit At1g77145

 
Sequence (A. th genome BLAST matches underlined)
>32-011521-rosso-C7-35St
TGGCGTAAGGGATGACGCACAATCCACTATCCTTCGCAAGACCCTTCCTCTATATAAGGA
AGTTCATTTCATTGGGATATATCCTTGCAGGCGGAGATTCGATTGTCGTTTCCCGCCTTC
GGGGGATACTTTCTTTGTGTGAAGCCATGTGTATGAGTACATTGACGTCATGGTGAAGGG
TGATAGCAACCGTGATGGCGTAAGCAAGCTGAAACGTGTGATAATTGATCTTGACTTAAA
AACTCAGTTTGAGCTATGGGATCTATACTTTACGGTTGACAATCCTCCTCCTCCACTACA
ATTCTTTATATAAGATAATATATTGAAGATAACTCCGCCTCACTACACCTCCCACCACTC
GCACCCCCCTCCTCGTCCCAGATGATATCATTAATATAGTTATGCAGATAAAAAATGCGC
GTCATGTCTATAACCGAATTAGACTCATGTCACTCTCACGAACACAACTCACTTCTCTTC
TATTATGAGTGTCCGCTTGTCTATATGGCTCAAGTGCGAAATACTCTTCTTTACAAAACA
ACGTTATGTTGTTTTCCTCCTGTATATAACATACACCAACCTCATCGCTCAATTAAAAAC
AGCAATTACACCCCTCGGCAGATAAATATAAACTACTGCTCCCCTACCTTATTCTCGTTA
TCTACCATCACTTGCGCGCTATCATCGGACTCCTATATCAAATTCAGTCATATACCGTAT
ACTTTATTAGCTCACCTTCTCCTTTTCTCTGTTTCATCATCTCCTACCCTCGCCACCTTC
TCTTTTTCTTATTCTTTCACCTATCAATTGCTATACTCGTCTCACCTGTCCTACTCCCAT
TATCTACAATTAACCAGCTATCAGCTCGACACAAAGTACTATGGAGGTGTACAATCCGGT
GACAGACATCTGTACTATTACCCCATGTATATTGTCAGCGTGATGCGTCCGCCCCGCGGA
CACGGGTACTACAGCACTCATACATACCTACGAGTACTGCACTTCTGTGCTGACTCTCTT
CCTCCCTTCATACCAGCTAATCAAGCAATA
GenBank Accession AL763945 [GenBank]
Graphic View Graphic view of gene At1g77145
Predicted Position of Insertion Chr1:28990616 - go to primer design
BLAST e Value 1e-50
Hit Clone Code (BAC ID) T14N5
Hit Gene Code At1g77145 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein of unknown function (DUF506)
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23