SimpleSearch - Line and FST details


Line specific information

 
Line ID 044H05
Vector Used pAC161
Line Availability only available from NASC (N404217)
Segregation Analysis 50:43:35
Confirmed for Hit T12K4 At1g48520
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At5g66880 can not be ordered because the confirmation of this insertion failed.

Gene hit At5g66880

 
Sequence (A. th genome BLAST matches underlined)
>40-K026600-022-044-H05-8409
CGGACAGAAGCCTTTACAATTGAATATATGCCGCCCTACATCGTCTCGTTACCAGAGTCT
TGCTATTGTGGGAGATCTTTTTCCACTTATTTTCGCGAATCTTCGTCTTCTTCCTATGGG
ATCCGCCCTATAGTGAGACTATGGGATCCTCCCTATAGCGAGTGGGATTACCCCCACCCG
TGTGGGATCCTCCCTAGAGTGAGAATGGTTGCCGGCCCATATTGGGATGTCA
GenBank Accession CR396050 [GenBank]
Graphic View Graphic view of gene At5g66880
Predicted Position of Insertion Chr5:26710541 - go to primer design
BLAST e Value 9e-07
Hit Clone Code (BAC ID) MUD21
Hit Gene Code At5g66880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation sucrose nonfermenting 1(SNF1)-related protein kinase 2.3
Insertion Classification TS2TE (5')
Confirmation Status failed, line belongs to a contamination group, please check line 800C12

Gene hit At3g42624

 
Sequence (A. th genome BLAST matches underlined)
>40-K015474-022-044-H05-8409
TAGTGAGAGGTGAACTACATGGAAACGTCATCGTCCTACTATCTTGAGTAGTAAGCAGGG
GCCGAAGTTGAGGCGGGAGGATTTTGCTCGTTCTGTCCGGTCGAGCGTATGGAAGCTCGT
CTCTATGGGATCCTCCCTATAGTGAGAAGAAAAAGAACGAGTAATTACCACTTTTTTTTC
AACCCAAAAAAGTAAATATCCGCA
GenBank Accession AL763967 [GenBank]
Graphic View Graphic view of gene At3g42624
Predicted Position of Insertion Chr3:14714633 - go to primer design
BLAST e Value 9e-39
Hit Clone Code (BAC ID) T12K4
Hit Gene Code At3g42624 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification TS2TE
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit AL763967 [GenBank]

Gene hit At1g48520

 
Sequence (A. th genome BLAST matches underlined)
>49-011521-rosso-H5-35St
CTTGAGTAAGGGATGACGCACAATNCCACTATCCTTCGCAAGACCCTTCCTCTATATAAG
GAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCT
TCGGTTTAAACTATCAGTGTTTAGTAAATAATGAACTTTGGAATTCAACAACTTTGGAAT
TCAAAACAGGCAAAGCACCAGGCAAACCCATACAAACAGGACAAATACTTGTGTTTGGAT
AAGAACCGTAATTGTTAGAGCAACTACAAAAGGCTTTTGTCAATGTAGAGAGCTGAACAT
GAGTCTCTATCCCAATTACAGCTTCGTAATCTCTCAGAATCTCATCAAGTTGGTTGCTTT
TGTGGTTTTTTGGAGCAACCCTTGTTGGAGAAGACTGTTTAGCTTCATGGGTCGTCGTTG
TTTGGCTTCCACAAGACCTCACGGAGAAGTTGTTACTCCTTCTCCTTCTTAACAAGCTAG
TTCCGAGAAGTGAGAACTGGTTTAGCTGAATTGTTCTCAACAATGTGGGATACATGTTTT
AAGGTGGGATCTAATACTTTCGGGTTGAAAATTCCANTCCCCTCCTCATAACATAATTTA
AAACATAAATA
GenBank Accession AL763966 [GenBank]
Graphic View Graphic view of gene At1g48520
Predicted Position of Insertion Chr1:17940564 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T1N15
Hit Gene Code At1g48520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GLU-ADT subunit B
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 31.08.2016 09:40