SimpleSearch - Line and FST details


Line specific information

 
Line ID 045H01
Vector Used pAC161
Line Availability only available from NASC (N404309)
Segregation Analysis 50:42:37
Confirmed for Hit At1g70700
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At3g23810 can not be ordered because the confirmation of this insertion failed.

Gene hit At1g70700

 
Sequence (A. th genome BLAST matches underlined)
>08-K015502-022-045-H01-8409
NTGATCCATGTAGCATTTCCCGGACCTGAAGCACTTTACAATTGAATATACTCCTGCAAA
AAAGCAATTTTCGAGTTTATACACTATGATTTGAGGAAGCAAAAATCTTGATTATATTTT
GTTTTGATGTTGATATTATACACACATACCTGAAGGAATCGTGTTACGAGGAGCTGCATT
GAATGATTCGATCATGCTCATTGCATTAGTCGCAGCAACGGGTGTGTCCCTACACCTTGA
GAAATTATCAGTGTGAGTGGCAAAGCTTGATGAGGTAGCAGCAGTGTTATGGATTTGCTT
TACATACATTCTTTCAGCTTCTCGAACCGGTTGGCTATCTGCAGTTTCACCTTTCAAACC
GTTCCCGGCGCATAACATGATGGCTTGAGCCTACTCACATATCATGAATAGTCCGTTTTA
GAACATGTAAATGTTATGTAAATGTTATTTGTATGAATCTTGATTATATATACCTTATCG
GGAGATATGTCATTAAAGACGCTTATAGTTCCGCCATAAAAGATTTNNGAGCTGAGGAGA
TGATCCGGAGGAAGCCACTCTGTTTCCACAAACCCACATAACCAAATCAAAATATGAAAA
GAGCAAAAAAATTGTTGAATGTTTTTGCATCATAATATGGAAATTACCGTGGAACAAGAG
AAAGATGAGTTGGTAAAGGAACTGAACCGCCTATGGGATCTC
GenBank Accession AL764057 [GenBank]
Graphic View Graphic view of gene At1g70700
Predicted Position of Insertion Chr1:26656569 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F5A18
Hit Gene Code At1g70700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation TIFY domain/Divergent CCT motif family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g23810

 
Sequence (A. th genome BLAST matches underlined)
>08-K015475-022-045-H01-8409
TTGATCCATGTAGAATTTCCGGGACATGAAGCCTTTACAATTGACAACCGTCTTTGATAA
TAGACAGGACGATCTGAAACTCGGGATTATCAGTAGAGGTCGGGTCAGGGAACGTACCAT
TCTTGGCAAAGATCTCTTCAGCTCTAACTCCTTCATGGATCAACAGCGTATCATCACCAC
CGTCATCAACGATGAGATCAGGACCACCTCCAGGACCCCAGTCAAGAGCTCTGTCTGTAC
CCCACCAATATTGTTGACGACCTCACCCTTCCC
GenBank Accession AL764056 [GenBank]
Graphic View Graphic view of gene At3g23810
Predicted Position of Insertion Chr3:8589120 - go to primer design
BLAST e Value 2e-101
Hit Clone Code (BAC ID) MYM9
Hit Gene Code At3g23810 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation S-adenosyl-l-homocysteine (SAH) hydrolase 2
Insertion Classification CDSi
Confirmation Status failed


Last Updated on 31.08.2016 09:40