SimpleSearch - Line and FST details


Line specific information

 
Line ID 049B11
Vector Used pAC161
Line Availability only available from NASC (N404631)
Segregation Analysis 100:99:70
Confirmed for Hit At3g17680
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g17680

 
Sequence (A. th genome BLAST matches underlined)
>82-K013870-022-049-B11-8409
TTTGATCCATGGTAGATTTCCCGGACATGAAGTCCTTTACAATTGACTGCATTTCGGACA
TTGATTCCGTTAGTGAGGTGCTGTTCTGAAGTTGAAAGACACCTTATCCTTTTCAACAGA
TGAAAGATCCTACTGCGGTGTCTGAGAAAGCCTATGAGCTTGTATCCCAACTTGTGACAG
CAAGCTTGGACAAAGAGATTCTGAAACACGAGTTACTTCACAAGGACCAACAGTTTCATG
AAGCCTCCAAGACTATAGAGCTGTTGAAGAAGTTTGTCATGTTGCTGGAGATGGAGAAAG
AAGTGGCTGTGGAGGAAAACGCTAATCTTGGCTACAAACTCACTTCTCTCTTGGAGGANA
ACAGAGAGCTATGGGATCCTCCCTCTCGCGAGACTATGGGAGCCCCC
GenBank Accession AL764099 [GenBank]
Graphic View Graphic view of gene At3g17680
Predicted Position of Insertion Chr3:6043801 - go to primer design
BLAST e Value 2e-157
Hit Clone Code (BAC ID) MKP6
Hit Gene Code At3g17680 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Kinase interacting (KIP1-like) family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL764100 [GenBank]


Last Updated on 07.07.2016 14:03