SimpleSearch - Line and FST details


Line specific information

 
Line ID 049C10
Vector Used pAC161
Line Availability only available from NASC (N404642)
Segregation Analysis 50:45:45
Confirmed for Hit MEK6
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit MEK6

 
Sequence (A. th genome BLAST matches underlined)
>26-K032734-0022-049-C10C-3144
CCTTCGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACC
CGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTGATCTTTTGCT
TTTTTCTACTAAGCAATGTTTGTAACCAACAAACAAAAAGTTCCATAAAACTGCTGTAAA
AAAAAATTAACTCACCAAACTCTCTGTTTGGTATTTTGTTAGATATTTATTTTAGTGTAG
TAAATCTTTCTCACTACTTCTTTGGACTTGTCATTTTCCTTAATTTAAAGGTACATAAAA
GCAACTCCAGCCTTGTATTCTTAGCAATAAAAGTGATTAAATTTAATGAAACAACAAACC
TTAGCTAAGATAAACATCTTAATTAAGATGTTTTCTTAAAACTAAGAAGAGTATATGTGT
TGTATTTTGAGTGGATAGACATTTTTGAATTGTTGTTTTTTAAGAATCCAATAGTTCTTA
ACCATTGAAATAGAAATTAGTTAAACTTCCTCCTAACTTTTCTTAACTTAGTAAAAACAA
CATTTTAATTTAAAATAAGGTTAAGATTCAAAACTAAGAACCAATTGGTTCTAAACCAGT
GGGGTAATAACTAAACTTTTT
GenBank Accession HG968648 [GenBank]
Graphic View Graphic view of sequence HG968648 of line 049C10
Predicted Position of Insertion Chr3:7709068 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MEK6
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03