SimpleSearch - Line and FST details


Line specific information

 
Line ID 049F01
Vector Used pAC161
Line Availability only available from NASC (N404669)
Segregation Analysis 50:43:41
Confirmed for Hit MIE1
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At1g30670 can not be ordered because the confirmation of this insertion failed.

Gene hit MIE1

 
Sequence (A. th genome BLAST matches underlined)
>06-K013870-022-049-F01-8409
NATGGATCCATGTAGATTTCCTCTGGACATGAAGGCATTTAGCATTGAACATAAGGGGTG
GAGATAATAATGAGTTTCTGAAGTTTTGGCGTGAGGAAGGAATCTAATTCCTGCGACTCG
TTGAAGACTCTGGTCTTACAGGCTATGGGATCCTCCCTATAGCGAGAATTTTGGAACAAA
TGTATTTTGGATTCCTAATAGTAACTTGTAAGTAGTAGGTCCAAATTTTTATGAGCACAT
GATGTGATTAAATCCTTGAAATCATTGTCATATTCATATAGAAGAAAGTCGAGATTTATT
ATTTATTATATTAAATCAATCAATAGAGGGAAGTGTCACTCACCTTGCATAATTGGTCTT
AAATGTCAGAAAGATTAAAGTTGGAAAGCTTACCTTTTTAATTAAGGAAGCTTTTTTCTC
CGAAACAAACAAATTACATACTTACTTACCGGGAAAGTCTAATACGATAAGCGGAAACAG
GenBank Accession AL753387 [GenBank]
Graphic View Graphic view of sequence AL753387 of line 049F01
Predicted Position of Insertion Chr3:4892071 - go to primer design
BLAST e Value 2e-126
Hit Clone Code (BAC ID) MIE1
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g30670

 
Sequence (A. th genome BLAST matches underlined)
>06-K013871-022-049-F01-8409
TGAGTTTCTGGAGTTTTGGCGTGTGGAAGGAATCTAATTCCTGTGACTCGTTGAAGACTC
TGGTCTTAGGCCTATGGGATCCTCCCTATAGTGAGACTGTGGGCTATTCCTTACTTTAAT
AAAAAAAAATCTATTATCTTATCTTTTATTTTTGTTCATAAAAGAAAATATATTTTTATT
T
GenBank Accession AL753388 [GenBank]
Graphic View Graphic view of gene At1g30670
Predicted Position of Insertion Chr1:10879952 - go to primer design
BLAST e Value 9e-27
Hit Clone Code (BAC ID) T5I8
Hit Gene Code At1g30670 [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix (bHLH) DNA-binding superfamily protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 060H06


Last Updated on 14.10.2014 10:23