SimpleSearch - Line and FST details


Line specific information

 
Line ID 050B11
Vector Used pAC161
Line Availability only available from NASC (N404727)
Segregation Analysis 50:50:37
Confirmed for Hit At5g64610
Parent of DUPLO pair 2212
Parent of pair(s) none

Gene hit At5g64610

 
Sequence (A. th genome BLAST matches underlined)
>82-K012138-022-050-B11-8409
TTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGGCGAA
CATGACAGCGATTAAAGCAGAAGATATATTAAGCACCCTGCAGAGCTTGGAACTGATACA
ATACAGGAAAGGACAACACGTAATCTGCGCGGATCCTAAGGTACTGGACCGACACTTGAA
AGCGGCAGGCCGAGGTGGTCTTGATGTGGATGTGAGCAAAATGATATGGACTCCTTACAA
AGAGCAGAGCTAAGAGGGCATTACACTTCAAATAGTTATGGTTATGGTCTACTTTTAATC
TGCATATCCTTAGATGACTTTTGTCTGTAACAATTTAACACGCACTCTGTTCAATAGATC
TTGTAACTGTAGGAATCTTTTGTCTGGATGGTAAAACGATCAGTAGTAACTTTGGTGTTT
CATTCTTGTTCCATTCTGATTGACAACAGTTTGGTTAAAATTTGGAATATTTGAAAAAAT
GCCGAAAGAGAAGTTTTATAACTAAATGTTAAAAATTTCTGGCTTTCTACTTCGGCTATG
GGATCCTCCCTATAGTGAGCGTANTN
GenBank Accession AL753435 [GenBank]
Graphic View Graphic view of gene At5g64610
Predicted Position of Insertion Chr5:25828527 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MUB3
Hit Gene Code At5g64610 [TAIR] [MIPS] [SIGnAL]
Gene Annotation histone acetyltransferase of the MYST family 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23