SimpleSearch - Line and FST details


Line specific information

 
Line ID 051E10
Vector Used pAC161
Line Availability only available from NASC (N404858)
Segregation Analysis 100:100:80
Confirmed for Hit At1g54830
Parent of DUPLO pair none
Parent of pair(s) 8037, 9683, 92414

Gene hit At1g54830

 
Sequence (A. th genome BLAST matches underlined)
>77-K012139-022-051-E10-8409
TTTGATCCATGGTAGATTTCCCGGGACATGAAGCCTTTACAGTTGAGGATATCCTGCCTA
TAGTGAGTCCTATTAGCTCAGAGGAAGCTTCCATGTAGTTAACAGCACTTAAGGCTCAGA
AACCGTCCACATGATGCTGGAATACTATTATCGCATCTGAAGCTCCTACATAATTGCCGG
AGAATAACATATAACCCTTAATTGACCGGGCTGCTTGACAGAACTAATGAATGATTATTG
ATCGCACAAAAGACACGAATTACCTAAGATAGGTGATTCCTTTTATACTGCGAAATGAAC
TTCCATATGTATATATGTNTGTAGGCTTTGATATGGGATCCTCCCTATAGGGAGTGGACC
CACTCAGAGGAGAACAAGAGAAGGACGTTGCAGAAGAATGATATCGCGGCTGCGGTGACT
ATGGGATCCTCCCTATANTGAGTCGTATTACTC
GenBank Accession AL753544 [GenBank]
Graphic View Graphic view of gene At1g54830
Predicted Position of Insertion Chr1:20451712 - go to primer design
BLAST e Value 1e-22
Hit Clone Code (BAC ID) T22H22
Hit Gene Code At1g54830 [TAIR] [MIPS] [SIGnAL]
Gene Annotation nuclear factor Y, subunit C3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23