SimpleSearch - Line and FST details


Line specific information

 
Line ID 052D04
Vector Used pAC161
Line Availability only available from NASC (N404936)
Segregation Analysis 50:47:39
Confirmed for Hit At5g65080
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At3g57630 can not be ordered because the confirmation of this insertion failed.
Although the line exists, the insertion in T21E2 can not be ordered because the confirmation of this insertion failed.
Although the line exists, the insertion in At1g70760 can not be ordered because the confirmation of this insertion failed.

Gene hit At3g57630

 
Sequence (A. th genome BLAST matches underlined)
>28-K012456-022-052-D04-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGCGACCGACAGACTATATCAGGCGTACTTACCGAGGACAAAATACCG
ATTATTAGAATATTTTGTTCTAAAAGAGGGCGTGACCTGGTATAATCGAGTCCTCATTCG
CCTGTGCATGCCATCCACAGGGGCCCGCTCGGCATTGCTTGTCATAACGCGCGAATATGA
CTTCTGATGAACCGCCCGCACCAGGGAGGGCCTAACGTCTGTACAGCATCCAAGATTTAT
ACCTAGGCTGATCCGAGTACCATATAATATACTCCTTATCTCCAGACTTTGAACTGAAAG
ATAACTTTGCCTCTTCTTTGTCTCTTTTGATTTTGAAGATGGCATTCTACGAGAACATCT
TGGCCACCGCTCATCGTACAATGAATGGACAAGAGGCACATCCCTTCTTTGTTCCTGTTC
TGGATTCATGCATTATAAATCGTGCTGATGATGCACCTCACATTAACATGCAGGTTTGGG
ATCGAGAAACTCACCTTTTGATTCTCTGCTTGTAGAAGCTTTAGAGCTCATATATTGGAT
ATGTTTTTATTACTTTCAGATTCATACTGGATTAAGAAGCTCACTTACCTTANAGTTCTA
CAAAAGGCTTATGAACACATTGTTGGAGAATATCCATACTGGGACCGCTCAGCTGGAAAA
GACCATATTGGGGGTTGATGATGCTTACCTACTTAGAAGCTGTTCCTGGATTCCTTACAC
AGAACACTCCA
GenBank Accession FR801461 [GenBank]
Graphic View Graphic view of gene At3g57630
Predicted Position of Insertion Chr3:21341381 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F15B8
Hit Gene Code At3g57630 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation exostosin family protein
Insertion Classification CDSi
Confirmation Status failed

Gene hit At5g65080

 
Sequence (A. th genome BLAST matches underlined)
>28-K104554-0022-052-D04-8409
ATCCAAGTTTCTTTTAAGTTGCTGAAAGAAAAGAACAAGGGTTCTAGGCGGAGGCACCCT
CCCGAGAGTGAGACTAATCACTCGCTGGCCCCGACTGATTGCCTCCCCCGCTGGATCCCA
CCCTCTGGGACCCAAAAAGGCGCCCCCACAATGGGATCCTCCCTGATCTGAGCGCTCATG
AGTCATGATGGGAGGAATGGGACCTCCCCCTAGACTTCTCTTGGGATTGCCTCCTCGATA
TAATAATTCAATGCGACCCCCGAGGGCGGGCGACTAAGTGTCCCCGGGTGTGGGCGGGGC
CCCAACCCATCCAATCCAACCNAGTTTTGGGGGGGCAATGANGGAAAGCAAACTATCCAT
AAAAACGCCCGGCACCGCAGAGCTTCCAGGTGGGACAGGCAGCGCGCTAGGAAGCCCCCC
CTCGAGTAGAGGCGCCCGNAGGGAGGAGCCAAGCGAGGAGCANCGGAAAGGGAACGGAAA
GGAAGCAATGAGAAGAGGGGAGAAGAAGGGAAAGGCGGGGAAGTAGCCGAGGACAAAAGG
GACGACGGGCG
GenBank Accession FR801463 [GenBank]
Graphic View Graphic view of gene At5g65080
Predicted Position of Insertion Chr5:26001575 - go to primer design
BLAST e Value 6e-05
Hit Clone Code (BAC ID) F15O5
Hit Gene Code At5g65080 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation K-box region/MADS-box transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit F3F19

 
Sequence (A. th genome BLAST matches underlined)
>28-K012473-022-052-D04-8409
TGATCCATGTAGATTTNCCGGACATGAAGCACTTTACAATGGCTGATCCAAGTTTCTTTT
AAGTTGCTGAAAGAAAAGAACAAGGTTCTAGCTATGGGATCCTACTCTATAGTGAAAGNC
GAAGGAACAAAGCCAACATAGGATCACCTCTCTTAGTAGTTACCAAACGCCATTGAGCCA
ATAAGGCGTGTCCTCTATGGGATCCTCCCTATAGCGAGTCGCTCATGAGTCATGATTGTA
TGAATGTGAACTTAACCTTGACTTCAAATGGGTTTATATCGTAAATAGAGTACTTCTATG
GGATCCTCCCTATAGTGA
GenBank Accession FR801462 [GenBank]
Graphic View Graphic view of sequence FR801462 of line 052D04
Predicted Position of Insertion Chr1:4457888 - go to primer design
BLAST e Value 2e-33
Hit Clone Code (BAC ID) F3F19
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At1g70760

 
Sequence (A. th genome BLAST matches underlined)
>28-K012482-022-052-D04-8409
TTGATCCATGTAGATTNTCCCGACATGAANGCCTTTACAATGGCTGATCCAACTTTCTTT
TAAGTTGCTGAAAGAAAAGAACAAGGTCCTATGTGATCCTCACTTATAGATAGGAAAAGG
CGAAGTGACAAAGCAAACATAGCATACTTCTGTTATTATGTTACCAAAAACCATTGATCC
AATAACGCGTCTACTCTATGGAATCCTTCCTATAGTGAGAACATAAGAAATGCTTTATTG
ACTATCGAAACTATGAGACGACAGGGGACCACTAACTCCTAAGTCGAGACATTCGTAACA
TGACCTTACAGACTTAACATAACCAGGAGTTAACAACCAGCAGGAATTGACCAGCGATGA
GCTCGATATCGAGATCATATGCGATCGGTACTTCCTA
GenBank Accession AL753693 [GenBank]
Graphic View Graphic view of gene At1g70760
Predicted Position of Insertion Chr1:26687425 - go to primer design
BLAST e Value 7e-15
Hit Clone Code (BAC ID) F5A18
Hit Gene Code At1g70760 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation inorganic carbon transport protein-like protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 052F01

Gene hit T21E2

 
Sequence (A. th genome BLAST matches underlined)
>28-K012359-022-052-D04-8409
TTGATCCATGTAGATTNTCCCGACATGAANGCCTTTACAATGGCTGATCCAAGTTTCTTT
TAAGTTGCTGAAAGAAAAGAACAACGCTTCTATGGAAGGCATCCTATACTAGAGTGAGAT
TACTCACTCANNCGCCTACCTTGGCTCACCTCTCTTAGCTATATCCAACGACCATTGAAA
CCAATAAGGCGTCGCCGAATATGGGATCCTCATTATTGCTGAGTCCATCATGCATCACAT
GATTGATATGAATGTGAACGTTACCCTTGACTTCAAATGGGTTTATATCGGACATAGAGA
ACTTCTATGGGATCCTCCCTATAGTGACTCGATNTACTCAGGGAAGACACACAGCTGTTT
TACAATGATTCAAAGAGACCGAACCTTAGTGGAATTGGAATGTTGAAATACTATTTAAGC
AGCTCAAACTATGTACCTTTTTCCATCTGACGTCTTGGGTCTTAAGCAGCCTCTCCACCA
TAATATACCGGCGATTAGAAGCACAGGAGACACCGTAGAAGCGATTACACTACCAACCAC
TGTACCAACAGAACTTCCACCACCAGTTCCAGTGCCCGGTTCCCTTGGTGGAATAAAATC
TA
GenBank Accession FR801460 [GenBank]
Graphic View Graphic view of sequence FR801460 of line 052D04
Predicted Position of Insertion Chr3:4992677 - go to primer design
BLAST e Value 3e-97
Hit Clone Code (BAC ID) T21E2
Insertion Classification Genome Hit
Confirmation Status failed


Last Updated on 07.07.2016 14:03