SimpleSearch - Line and FST details


Line specific information

 
Line ID 052D06
Vector Used pAC161
Line Availability only available from NASC (N404938)
Segregation Analysis 50:30:28
Confirmed for Hit At2g46740 At5g55090
Parent of DUPLO pair 2682
Parent of pair(s) 4491, 4644, 4704, 10023, 10899

Gene hit F17C15

 
Sequence (A. th genome BLAST matches underlined)
>44-K012299-022-052-D06-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCACGTGCTTACAACAGTATGGATGATTGATCATTAACCGCTGAATCGAC
CTGAGCTTACCTCACGACTCTTACTCTCTGTGCTGCATATACATAACTCTCATCTCCATC
TGTTTCTCTCTCTATGGGAGCCCCCGTATGAAGAGCCGTATTACTCCACGGCGAATGTAG
CTACGCCATAGTAATACGCGCAATCTTGGAAGTACGAAATCTACATATCCACGTGATAAG
GGGCCCGTTGATTAGACGCCGCCAAATGGACGCCCAAGATGGCGACGTTGTCGAATACCA
CTGCCATCAACCCCTTGGCCTGGGCATATGGAAATACGAGAACGCTTCTTACATTGGCGC
TGAGAGCTCGCGCCTGCAAGTAAGTGCTGCCATTTACATGGACCCTGTCAGTTTACAGCA
TTGGGTTACTGGCTACGGTAACCTGCCTTAGTAAACGTCATGGCAATCAGCCTTATAACC
GTAAGGGAAGTACTAAAGACTCAAGGNGGNNCGCGGCGGGGGGGGGGGGGACCGCCGACA
GAGAGCCCGCGCGCCCGCCCCNGCGCCCGGCGGCCGCGCGCGCGGTGGGCGGTGGGACAC
CGGGACGGGGCCGGGGGCGGGGGTGGGCGGCGCAGGGAGGCCGGGTATGGCGCAAGAGGA
TGGGGANAGGGGGCGGGCGGGCCGGGCCCGCGGCCGGTGGCGNGGGGGGCTGCGAGCCGG
GCGGGGGCGGAGCGGGACCNCAGNTGTCAGCAAACAACACGGAGAGGAAGGAAAAAGAAA
GAAAA
GenBank Accession FR801467 [GenBank]
Graphic View Graphic view of sequence FR801467 of line 052D06
Predicted Position of Insertion Chr5:962113 - go to primer design
BLAST e Value 2e-18
Hit Clone Code (BAC ID) F17C15
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At2g46740

 
Sequence (A. th genome BLAST matches underlined)
>44-K012303-022-052-D06-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACATTTGAGAAGAAGACGAACAC
GAGACGATCAGGGTAAGTGTTAAAAACTTATAAAGAGACAAAAGTGACAGAGAGAACAGA
GCGGAACGGATCGGGGACGGAGGTGTTTTTACGTACTATAAGGATTGACAACCGTGGGAT
TAAAATTTGAGATGTTGAAATGTAAACTTGGAGATCTCAAACCATTTAACTTGATGTATG
GGATCCTACCTATAGTGAGTTACACGCATTTTCCGTCCGGCTTTACTAGCTGCAGCGACG
ATAGATACAAGCTCGGCTTCAGTTGTTGGGTAAGCCACGTTGGCGGCTCTACACGTGGAG
CGGTCTGGGAAGGCTCCTAATGAGTTGGTGACTATACAGTTCGTGTTTCCTGACACACAT
TTAACAGGATCTTCGGGTGGTGTTGAGATTACCGTGTGCACAAGTGTAAATAAACAATAT
AACCCGAGAAGGGTGCGCCAAAACGAACAATAGGAAGGAGAATAACCAAATGCCATGCGT
TTTTATTGAGTTTTGTCTAATGGAGGCGTTTCTAAATGTTTGGTATATATAGTGGTTGTG
GCTTAAAGGCCGGTTCAGTGATGCATCATGCTATGGGATCCTCCTATAAAGGGAACCCCA
AAAAGCNCCCCTCCNCTCACTTGGTCTTCTACACCCACCAATGCCTAATACTCCTCTTCT
CGGTTGTGCGACATCTCGCGAATAAAACGATAGGCATAAATATATAAAAGAAAATACAAA
GenBank Accession AL753702 [GenBank]
Graphic View Graphic view of gene At2g46740
Predicted Position of Insertion Chr2:19206978 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F19D11
Hit Gene Code At2g46740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation D-arabinono-1,4-lactone oxidase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g55090

 
Sequence (A. th genome BLAST matches underlined)
>44-K104556-0022-052-D06-8409
AGAAGATCAGAGACGACGAGGTAAGTGTTAAAAACTTAGAACAGACAAAAGTGACAGAGA
GAACAGAACGGAACGGAACGGGGACGGTGGTGTTTTTACTTCTTAAAAGGATTTACATCC
GCTCGATTCTCATCTTCTATCTCGAAATCGTTTCTCTATCTCCCCCCTCCCTTTAACTCA
CCCTATCGTTTCCCCCTCTGGTTCACCCGAACTCTCCTCTCCGGCGAGTTTCTTGATCCG
ATCACCCGGTAAAGAATCGTCATCCCATAAGAAATTTGTAGAATTTGCAAATGGGTCTTC
GTGATCCTCTTTAATGAATCTACTTCTCGAAGTTTCACATAAATCCCAAAACCGTTGATC
CAACACAATACTATGGGATCCTCCCTATACTGAGACTTATTACTCCTCCCTTTAGTCTGG
CTGTGTCGGCCTGCGCCATGGCGTCCCCCCCCTGTATGATAACAGCCGATTACGTTGTGG
GGAGGGGTAGGGCGCTAGCTAGTCAGCGGATCACGCCCTATGGGCCCGGGTGGGGAGCGC
CGCTGATACGGCACGGCCGCTGTGATCGTGAGCTGCTCATTTTGAGCGCTGCGAAAGCGA
GCTTCATCGTCCTGTTGTGATCGACTACGAGCCTCTCGCGTAAGCCGCCCGAGGGCGGGC
GGGTGCCTGTCCTCTAGTGAGCCCCGGCTACCTCGGGTCGCTATACGCCGTCGTGTCGAC
CGTCCGGCCCTGCACGCGCCGCCCGATGGAGGGCGCCATCCTGTACTCAATGTGCACCGT
GAAGACGCGCTAGTTGTATGTCCCTCCAGCTCTTTCTAGGCGCCTTGCACGCAGGTCACC
CGCTGTCAGGTGCTTCTCTCTCTCCGGTCAC
GenBank Accession FR801472 [GenBank]
Graphic View Graphic view of gene At5g55090
Predicted Position of Insertion Chr5:22357010 - go to primer design
BLAST e Value 2e-90
Hit Clone Code (BAC ID) MCO15
Hit Gene Code At5g55090 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation mitogen-activated protein kinase kinase kinase 15
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL753705 [GenBank]

Gene hit At2g46700

 
Sequence (A. th genome BLAST matches underlined)
>44-K104554-0022-052-D06-8409
ATTTCATTAGAGAAGAAGAAGAACAGAGACGACAAGGCTAAGTGTTAAAAACTTAGAAGA
GACAAAAGTGACAGAGAGAACAGAACGGAACGGAACGGGGACGGTGGTGTTTTTACGTAG
TAGAAGGATTGAGAACCGTTGGATTAAAATCTGAGATGTTGAAATGTAAACTTGGAGATC
TCAAACCATTTAACTCGTTCTATGGGATCCTCCCTATAGTGAGACTAATTAATCCCCCCT
CTAGTCTTAATTGGTGACTCACCCAGTAATGAATCCTCGTCATCACCTAATTGTGTGGAA
TTTGTTCATGGTACCACCGGAAGCTTCGTTGGTGGATCCACTTTCCAGAGTTACGCATAA
ATCTCTAAGCCTTTCGAGCGAGCGCGGTTATTTAGGCTCCCAGATGAGGTGGGGCAGAGA
GGTGAGAGAAGAGATGCGACCAGGGGGGAGGAGGCGGGGGGGGCGGGAGAGAGGGGAGGT
GGTGATGGAAGGAGAGGGAGAGGAAAGGGATGAGGGACAGTGTCGATGAAGGCAGAGCGC
GACGAGTGGAGAGGAGATAGTGAA
GenBank Accession FR801471 [GenBank]
Graphic View Graphic view of gene At2g46700
Predicted Position of Insertion Chr2:19186554 - go to primer design
BLAST e Value 5e-101
Hit Clone Code (BAC ID) T3A4
Hit Gene Code At2g46700 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation CDPK-related kinase 3
Insertion Classification TS2TE (5')
Confirmation Status unknown


Last Updated on 07.07.2016 14:03