SimpleSearch - Line and FST details


Line specific information

 
Line ID 052H08
Vector Used pAC161
Line Availability only available from NASC (N404988)
Segregation Analysis 100:81:62
Confirmed for Hit At5g13750
Parent of DUPLO pair none
Parent of pair(s) 3207, 9652

Gene hit At5g13750

 
Sequence (A. th genome BLAST matches underlined)
>64-K012303-022-052-H08-8409
TGTAGATGAAGGGACAGATGTTGGTTCTGTTCTTGCCTTTTCAGGTGTGTTTCTACTTCT
TAATTCTAACATATTCAATAGAAAGTGATTGTTCTAACCTAAAAACCACTGCTTTCTATG
GGATCCTCCCTATAGTGANCAACAAANCATTACAAGTTACTACTACTAGGTATACACGAC
CTATCATAGCGACACCTATATATGGGGTAAGCACTATATACTCTGTTGTTCTTACTGCAA
AACCTTGTGTTTTCTTTAATAAGACAGTCCTAATCTTGTGATTGTTTCTGATACTCACAG
AGCCTATGGCATCCTCCCTA
GenBank Accession BX511274 [GenBank]
Graphic View Graphic view of gene At5g13750
Predicted Position of Insertion Chr5:4440223 - go to primer design
BLAST e Value 1e-47
Hit Clone Code (BAC ID) MSH12
Hit Gene Code At5g13750 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation zinc induced facilitator-like 1
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL753914 [GenBank] FR801585 [GenBank] FR801583 [GenBank]

Gene hit At5g02450

 
Sequence (A. th genome BLAST matches underlined)
>64-K104556-0022-052-H08-8409
CCACTCAGGTGAGTGATCATAATCAGATCTTTTCGCTTTATTGATTTCATATGTAGTCTC
TTTCGATTAGTGTGAAAGTTTTGGAATCGACAAATCTTTACGAGTTACTACTACTACTAT
GGGATCCTCCCTATAGTGAGTCGTATTACTCNN
GenBank Accession FR801586 [GenBank]
Graphic View Graphic view of gene At5g02450
Predicted Position of Insertion Chr5:533184 - go to primer design
BLAST e Value 2e-59
Hit Clone Code (BAC ID) T1E22
Hit Gene Code At5g02450 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribosomal protein L36e family protein
Insertion Classification TS2TE (5')
Confirmation Status unknown
Other FSTs Supporting this Hit FR801584 [GenBank]


Last Updated on 07.07.2016 14:03