SimpleSearch - Line and FST details


Line specific information

 
Line ID 053C12
Vector Used pAC161
Line Availability only available from NASC (N405028)
Segregation Analysis 50:44:37
Confirmed for Hit At5g53530
Parent of DUPLO pair 2124
Parent of pair(s) none

Gene hit At5g53530

 
Sequence (A. th genome BLAST matches underlined)
>91-K012358-022-053-C12-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGAATATTGTACGCTTAA
TTCCATTGGACCCTTACCCATTGTACAGATGGAAGTTGGAATCGAGGACTGTCTGCATAT
CGAGTTTGAGTACAATAAAAGCAAGTAAGATAAACTGATTTTCGTAACTTTGGGTTTCGA
GCGATGTGGAAAATATAAAACAGTAGCTAATTCTGTATGCTCTCGATGCAGGTATCACCT
AAAAGATGTTATCCTTGGGAAAATATACTTTCTTCTGGTGAGAATCAAGATAAAGAATAT
GGATCTTGAGATAAGACGGCGAGAATCAACTGGAGCAGGAGCTAATACTCACGTCGAAAC
AGAAACACTATGGGATCCTCCCTATAGTGAGTCGTATTAC
GenBank Accession AL754070 [GenBank]
Graphic View Graphic view of gene At5g53530
Predicted Position of Insertion Chr5:21746895 - go to primer design
BLAST e Value 4e-180
Hit Clone Code (BAC ID) MNC6
Hit Gene Code At5g53530 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation vacuolar protein sorting 26A
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL754072 [GenBank]


Last Updated on 07.07.2016 14:03