SimpleSearch - Line and FST details


Line specific information

 
Line ID 053G03
Vector Used pAC161
Line Availability only available from NASC (N405067)
Segregation Analysis 100:100:85
Confirmed for Hit At3g02840 At1g04180 T20L15
Parent of DUPLO pair none
Parent of pair(s) 42850, 84578, 84579, 84580, 84581, 84582, 84583, 84584, 84585, 84586

Gene hit At3g02840

 
Sequence (A. th genome BLAST matches underlined)
>23-K012358-022-053-G03-8409
TTGATCCATGTAGATTNTCCGGCACATGAANGCCTTTACACTTGCTTATCTTATCGTGGT
TGGTTCTATGGGATCCTCCCTATAGTGAGTCGNATTACTCAGAGACGGGCTCAATGGATT
TTCGGCGATTTCTCCGTCGGGGACACCAAGATTACATTTCAGCTCCGATCGCCATCAAGG
ATAGAGCGGATTCAGTCGCCGCGCGTGCTGTCGACGCCGCGTGATGCGGGGGAGATAACG
TCGGTGATTGCAAAACTCAGGGATGCTTGATAGAGTATGCCGAGTGTTTGGAGATTGTGA
GCAAAATCAAGAACTTGGGAAGAGGAGGGGACACGAACAAGAAGTGTTTGGTCCAAAACG
GAAGCGTTTTGGCTTTGTCTTCTTGTTTTGAAAGATTCGCGGCGGCGCGTGATGGACACA
TGCGTTTATTGGAGGAAATCTTGTTTGTTCTATCATCTTGGTTGCCTCTGAATCGATCAN
AAGGTTTCAACAAGATGGGATCAACGGCTTCTCTTAACTGTCTCGTACGGGTCTTGAACG
GGAAAGGACGCTAAAACGAAGCCAAAACGCTGCGTTTTGCATCAGAGAGGTTATTGCAG
GenBank Accession BX890731 [GenBank]
Graphic View Graphic view of gene At3g02840
Predicted Position of Insertion Chr3:618475 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F13E7
Hit Gene Code At3g02840 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARM repeat superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At1g04180

 
Sequence (A. th genome BLAST matches underlined)
>23-K012472-022-053-G03-8409
TTGCTTATCTTATCGTGGTTGGTTCTATGGGATCCTCCCTATAGTGAGCTTAAAAGGCCT
GACATCGGCCCATTGGAGCTTAAAAGCATGACAGGATAGACGCCGGTTCTTGACATCGGT
GCTCTGGAGAAGATAAAATCCGGCGACGTAGAAATTGTACCTGCAATCAAACAGTTCTCG
CGTCACCACGTGGAGCTCGTAGATGGTCAGAAGCTATGGGATCCTCCCTATAGTGACCCN
GGNNGCGTGGAGACTCCCCTACATGGTGTGGAACCCTCCACTAAGAGCGGCCACATACAG
GATGTGGTCGGTCGACATCGGAATCGATCCGGCTTGAACATATTCTTACGCAAGATCCGC
ATAACCACTGTGACTGACACGTGCGACTATCGGAGGATGTCATAGTAGTACTATAATTTG
TGATGCCTCTGGAACGAATAATACGTGCTCGCAACATTGCAGTGACGCGCTTTGTTTTAA
TGGCTATGTCAGCTTTTGTATAGGGAAGGACCCTAAAACGAGACAAACCGCTTGCGTCCT
GCATCCCAGAGGTTATTGC
GenBank Accession AL754210 [GenBank]
Graphic View Graphic view of gene At1g04180
Predicted Position of Insertion Chr1:1105503 - go to primer design
BLAST e Value 7e-86
Hit Clone Code (BAC ID) F20D22
Hit Gene Code At1g04180 [TAIR] [MIPS] [SIGnAL]
Gene Annotation YUCCA 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR801704 [GenBank]

Gene hit T20L15

 
Sequence (A. th genome BLAST matches underlined)
>23-K012385-022-053-G03-35St
TGACGTAAGGGATGACGCACAATCCACTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCATTTATCGGTTTTTGGTACGAACACTACTTGTGTATTACTATTACTAA
AACATATAATAAAAGTGTCAGTGTCAAATGTCAATGTAATTTAATTTAGGGGAAAATGAA
ATGGCCAACATAATCTAACACAAAATCAATGAAAATGGAGAGAGCATCTCACTCACCTTA
TAATAACCTTTATATTTTCCACGTATGTGGGCCCCCTCACATAAACCTCTCTTTCCTTTA
TAAATTCTCCACTCTTCACACTCTCACTTTTGTTCATGTACCAAAGAAGTCCCCAACAAA
CACAAAATAATCAACAGAGAGAGTCAGAGAGATAATGGGTAATAACTATCGGTTTAAGCT
ATCGGAGTTAATCCCTAACGCTTGGTTTTACAAAACTTAGAGACATGTCCAAATTCAAGA
AGAAGAATCTTCAGAGCCAACCAAATAGCACCCACCTTCAAGAAGAAACACCACGCAAGT
CCCCTACTCCTACGTCCACAAAGCCACTCATTCCTATGGGATTCCTTCCTATAAGGGAAN
AAANACNANNCCGTTTACAAACACACATCGCTCATTTCAAACACAAACAGGCTGTGGTGT
AAATTACCATCTATCACACTATTCAACCATGTCAACACAAGATACAAACAACTAGAACAA
CCCCCATACCTCCTTCTATAACTCGCTCCAATCTCCCGGCCTTCTCTTTAAATTCTAAAA
CCCGACGTACCACTATACAAACGCAACTATAAAAACCTGTTATCTATTTTATTCATTTTT
AT
GenBank Accession AL754209 [GenBank]
Graphic View Graphic view of sequence AL754209 of line 053G03
Predicted Position of Insertion Chr5:324241 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T20L15
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23