SimpleSearch - Line and FST details


Line specific information

 
Line ID 053G05
Vector Used pAC161
Line Availability only available from NASC (N405069)
Segregation Analysis 50:49:39
Confirmed for Hit At3g27650
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g27650

 
Sequence (A. th genome BLAST matches underlined)
>49-K104196-0022-053-G05C-8409
TTCGGACTGAGCCATTTACATTGAATATATCCTGTATTGATGATGATACCATTTTATTGC
TACTTTGCTAGTTACCAAATTCAAAATGGAAATAAAACATTTGAAACTGTATCAATTTTT
AAAAAGTGTACGTAGACATATTGTTGATAAGATATTGATAATTGATGTATATAGAAGAAG
AAGAGACTCCAGAGAATTACAATATCGATCGATATGGATCAAAATTCATATCAATCTTAT
ACTGTAGTTTCGAGAATTACTAATAAGATACTATGATGTGATTAAATCGTTTTTGCCATT
TTTTTGCAACTGAAAAATCAGGGGATATATATGTCGAACTACACAAACTCACCGTGTGCA
GCATGCAAATTCCTCCGGCGTAAATGCACGTCAGACTGCGTATTCGCACCCTATTTTCCG
CCGGAGGAACCTACAAAGTTTGCGAACGTCCACCGGATATTCGGGGCAAGCAATGTGAGC
AAGATCCTCCACGAAGTGGCTCCCCATCAGCGGGAAGATGCGGTCAACTCGCTGGCTTAC
GAGGCGGAAGCACGACTTAAAGATCCAGTGTATGGCTGCGTTGGAGCGATCTCGGTGCTC
CAAAGACAGGTCTTGAGGTTGCAAAGGGAACTCGAGGAGACAAATGCT
GenBank Accession HG968657 [GenBank]
Graphic View Graphic view of gene At3g27650
Predicted Position of Insertion Chr3:10239662 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MGF10
Hit Gene Code At3g27650 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation LOB domain-containing protein 25
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL754218 [GenBank] AL754218 [GenBank]

Gene hit MNC6

 
Sequence (A. th genome BLAST matches underlined)
>39-K012298-022-053-G05-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTAAATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAG
TATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAA
TGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTAC
GATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTAT
TTCGACGTGTCTACATTCACGTACAAATGGGGGCTCCCATGACAAACTCCACGATCGACG
CCTTGATTTCGCCATTCCTAGATACCCATTTCATCCCACCACGGCCCTGAAACCATGCAC
ACACACCCACCCCACTCCTCAATACTGCCACCCCCGCGCCCCCCACTCCCCACGGCCCCC
TAACATTACATAATTCACTCACCCCCATAACCGACCCCTCCCTTTCGTGAGTCCCCTTCT
TCCCCCCCCCACCCACGTCCAACACCCCCCCCACCCCACCCCCGCACCACCCCCACACCA
CCGGACCACCGCCCGACCCCCCCGCCCCCACCGGAAGGGCCCCCCCCCACACTCCCCACC
AACCCCACCCCCCACACACAGGCCCCACCCCAACCGGACACTCCAACTCGCCCTCTCCCC
CTTTATATTACAGAGTCTCTCCTCCTCTCACATTAACACTCTCGAACCAGATCATTACGT
ATCTTACCGATGCCACAAAATGCTATCTTGCGCCGCTCTTCCACGCGCCCCCCTCCCGCC
CCGCCGCGCGCCACCACTAAAACAAAACGCCCAATCAACACACTCCACCAAACCCCTCCC
A
GenBank Accession FR801710 [GenBank]
Graphic View Graphic view of sequence FR801710 of line 053G05
Predicted Position of Insertion Chr5:21768086 - go to primer design
BLAST e Value 0.38
Hit Clone Code (BAC ID) MNC6
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40