SimpleSearch - Line and FST details


Line specific information

 
Line ID 053G08
Vector Used pAC161
Line Availability only available from NASC (N405072)
Segregation Analysis 165:139:107
Confirmed for Hit At1g18150
Parent of DUPLO pair none
Parent of pair(s) 2397, 84328

Gene hit At1g18150

 
Sequence (A. th genome BLAST matches underlined)
>63-K012298-022-053-G08-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTCATGAAGACATTACCATTTGGAGCATGATGTCTGTGAAGTGCAGTACTTCTTCCTC
CTCCTGCTGCTCCTGGTTTACCTTGATTTTCTTCAAGATGAGCAAATTGCCTTTTAAATC
GGTCTACCCCACTGCGCGTAAACAACAAAAAGATTTATCGAGTTCATAACTTTCTGTTTT
CAAGACTTATAGTTTCTGTTAACTGTTAATTAGCTAACCTTGGGTACATAAAGCTAAGCT
GATCACCACCACGAAGGTATTCCTCCAACATCTGAGGATGATATTCCAATATCTGATATT
TACAAAATCCAAAGAAAAGTGATTGTTAGGATCAATGAATAACATTGAAACAAATTCAGA
TTAAAGAAAAGGATATATGTAGAAGGCTTTTGTGTTTGTTTGTTACCTCTCGGTAAATTA
ATTCTCTGACATCATCTTTAACTAACTTCTTTCTCTCAAAGTCAAATTCAAGCTTTGAAA
TTGGCTGTGTTTGTTGGTTCACGCTCTGAATTTGACAAACCACTGAAATATGGATCAGCT
ATGGGATCCTCCCTATGTGAGTCGTTTTA
GenBank Accession BX649672 [GenBank]
Graphic View Graphic view of gene At1g18150
Predicted Position of Insertion Chr1:6245118 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T10F20
Hit Gene Code At1g18150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR801716 [GenBank]

Gene hit At3g32880

 
Sequence (A. th genome BLAST matches underlined)
>63-K012481-022-053-G08-8409
TATGCATGTTTTTGAAAGACACCGATCCTTTGCGCCTATCCTCTGGAACTCTACCTATGG
GACAACTCCCTCAAGACATGCCCTCCCAGATACATGACGCGCCCGAGCCAATTGGGAGCA
CGGCCTGATCCTATGGGCATCCTCCCTATAGATGACTGCACGTGCTGTCGAACCTTCAAA
AGCTGAAGTCGGCGTTGGGGCTTCCGCTATTGGTCTCGGTGTCGCGGAAATCCTTCTTGG
GCGCCACCGATGGCCTTCCTGTAAAGGATCTGGGTCCAACGAGCCTTGCGGCGGAACTTC
ACGCGATCGGCAATGGCGCTGACTACGTCCGCACCCACGCGCCTGGAGATCTGCGAAGCG
CAATCACCATCTCGGAAACCCTCGCGAAATTTCGCAGTCGCGACGCCAGAGACCGAGGGT
TAGATCATGCCTATGGGATCCTCCCTATAGTGA
GenBank Accession FR801717 [GenBank]
Graphic View Graphic view of gene At3g32880
Predicted Position of Insertion Chr3:13405270 - go to primer design
BLAST e Value 4e-07
Hit Clone Code (BAC ID) T7B9
Hit Gene Code At3g32880 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification TS2TE
Confirmation Status unknown


Last Updated on 31.08.2016 09:40