SimpleSearch - Line and FST details


Line specific information

 
Line ID 053G11
Vector Used pAC161
Line Availability only available from NASC (N405075)
Segregation Analysis 100:79:61
Confirmed for Hit At1g43160
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g43160

 
Sequence (A. th genome BLAST matches underlined)
>87-K012358-022-053-G11-8409
TGATCCATGTAGACCTTCCCGGACATGAGAGCCTTTACACTTGAATGATTCTCTTTCCGA
TCAATATTATCTCCCCGGGTTCAACTTGTCTCCACCGCAATTTAAACATGGTGTCTATGC
TGACTAATGTTGTCTCTGGTGAGACCGAACCCTCGGCATCTGCGACATGGACGATGGGTC
ATAAGAGAGAAAGAGAAGAGTTTTCTTTGCCTCCTCAACCATTGATTACCGGTTCAGCTG
GTATGCATGTTTTTCTAAATCGAATTTTTTTTTGTTGAGAACACTATACTAACCAATAAA
ACATTCTTTAACCAAAAACAAAAATCAATAAAACAGTGACTAAAGAATGTGAAAGCTCAA
TGTCCTTGGAGAGGCCAAAAAAATATACAGGAGTAAGGCACCGACCATGGGGAAAATGGG
CGGCGGAGATTCAAGACCCACACAAGGCGACACGTGTATGGCTTGGGACATTCGAGACAG
CCGAGGCCGCCGCAAGAGCCTATGATGCGGCAGCACTTCGTTTTAGAGGAAGCAAAGCAA
AGCTTAATTTCCCCGAAAATGTTGGAACTCAGACGATCCAACGAAATTTTCTTTTTTTGC
AAAACTTTATGCAACCTTCTCTGACATACATCGATCAATGGCCCACCTCTATTATCTTAC
TCTTGATGGTATGGGCCACAACCACCCATTTATTAGGCATGTTGCACCCAACAGAAGAGG
AAAAATCCTTTTTTCGAAAACCCTGGGCCCGGATTTGATCAATCCAATCACTCCTTTTTT
GGTAAACTAAACTATGGGCAACGCTTTG
GenBank Accession BX649676 [GenBank]
Graphic View Graphic view of gene At1g43160
Predicted Position of Insertion Chr1:16263938 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F1I21
Hit Gene Code At1g43160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation related to AP2 6
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL754241 [GenBank]

Gene hit F21M11

 
Sequence (A. th genome BLAST matches underlined)
>87-K012428-022-053-G11-8409
TGATCCATGTAGCATTTCCCGGACATGAAGCACTTTACAATTGAATATTTCTCTGGTTAT
AGCAATTTCATTACTTTTGTTCTCCACTGCGTGCCGTTTTCCATCAACGAAAGGGAGAGA
CGTCATGCATGCATTCTATGGGATCCTCCCTATAGTGAGTCGTATTACTCAANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNGNNNNN
NNNNCTATAGGGAGGATCCCATAGAAAGCATGCATGACGTCTCTCCCTTTCGTTGATGTG
AGGACGGGGCGCAGTTGGAGACCACAAGTATGAAATCGCTTATAACCAGAGAAATATTCA
ATTGTAAATGGGCTTCTGTCCGGGAAATCTACCTGGATCAGCAATGAGTATGGAGGGGTC
ATATGGGGGGAAAAGGACAGAGTGGTACCAATTTTTTGTCCCTTCAAAAATGGTAGATCG
TCGCAGCGGTTATTATAANNN
GenBank Accession AL754240 [GenBank]
Graphic View Graphic view of sequence AL754240 of line 053G11
Predicted Position of Insertion Chr1:984389 - go to primer design
BLAST e Value 3e-26
Hit Clone Code (BAC ID) F21M11
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 07.07.2016 14:03