SimpleSearch - Line and FST details


Line specific information

 
Line ID 054C08
Vector Used pAC161
Line Availability only available from NASC (N405120)
Segregation Analysis 100:91:87
Confirmed for Hit T4L20
Parent of DUPLO pair none
Parent of pair(s) 1571, 9659

Gene hit At2g14010

 
Sequence (A. th genome BLAST matches underlined)
>59-K012427-022-054-C08-8409
NTGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACATTTGAATATATACTGTACAA
CTCTTGGGCCCGGAATTTGGACAGGCTTGAATGGTATCCTGAGTATCCTGAGGCGTAGCC
TAACAAACGAATGGGTGACAGATGAAGGAATACTTCTACGGTACGCTGCTCTATCTTTTA
CTGATGGACCGGAGTGCTCCACTTCAGAACAAAGACAGATCTTTACGGTCTCGCGCACAT
GTACAATCATCTACGTGGGTCACACTTTCGAGCGACAACATCGTGACCAATTGCGAAGAA
CTAATACGGGACGACCGACTGACGGAGCCTACTTACTGCATTACATGGGGGAGGATGGCA
TTCTCCTAGATATCCACCAACCAAAGCTGAATGATGCCTAACTAAACATAAGCGCGCATC
GCGATGCCCTGTAACAGTGGCAACACCGTATGGCATACTATTTACTGGCGAACTACTTAC
TCTATGGGATCCTCCCTATAGGGAGTCGTATTACTC
GenBank Accession FR801756 [GenBank]
Graphic View Graphic view of gene At2g14010
Predicted Position of Insertion Chr2:5888699 - go to primer design
BLAST e Value 9e-05
Hit Clone Code (BAC ID) F9B22
Hit Gene Code At2g14010 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification TS2TE
Confirmation Status unknown
Other FSTs Supporting this Hit FR801757 [GenBank] FR801756 [GenBank]

Gene hit At4g17520

 
Sequence (A. th genome BLAST matches underlined)
>59-K012489-022-054-C08-35St
TACAATTAGGAAAGCCAGACAGAACTCGATCGGTACTAGACTAGACAAACAATGAAGAGT
GCTGGGAACGTCTTCTTTTTCCACGATGCTGCTCGCGGGGTGGAGGCTCATTTTAGGGAA
CATTTGGATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAA
TTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACGTCCAAATGGGGGCTT
AGATGAGAAACTTCACGATCGATGCCTTGATTTCGCCATTCCCAGATACCCATTTCATCT
TCAGATTGGTCTGAGATTATGCGAAAATATACACTCATATACATAAATACTGACAGTTTG
AGCTACCAATTCAATGTTTCCCATTACCTTACATAATTCACTCAAAATGCTATGG
GenBank Accession FR801758 [GenBank]
Graphic View Graphic view of gene At4g17520
Predicted Position of Insertion Chr4:9772271 - go to primer design
BLAST e Value 4e-10
Hit Clone Code (BAC ID) FCAALL
Hit Gene Code At4g17520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Hyaluronan / mRNA binding family
Insertion Classification CDSi
Confirmation Status unknown

Gene hit MNC6

 
Sequence (A. th genome BLAST matches underlined)
>59-K012297-022-054-C08-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGTT
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTCGGATATATTCAATTGTAAATGGCTTCATGTCCGGGAAATCT
ACATGGATCAGCAATGAGTATGATGGTCAATATGGAGAAAAAGAAAGAGTAATTACCAAT
TTTTTTCCAATTTTAATATGTAGATGTCCGCAGCGTTATTATAAAATGAAAGTACATTTT
GATAAAACGACAAATTACGATCCGTCGTATTTATAGGCGAAAGCAATAAACAAATTATTC
TAATTCGGAAATCTTTATTTCGACGTGTCTACATTCACGTCCAAATGGGGGCTTAGATGA
GAAACTTCACGATCGATGCCTTGATTTCGCCATTCCCAGATACCCATTTCATCTTCAGAT
TGGTCTGAGATTATGCGAAAATATACACTCATATACATAAATACTGACAGTTTGAGCTAC
CAATTCAGTGTAGCCCATTACCTTACATAATTCACTCAAATGCTATGGGATCCTCCCTAT
A
GenBank Accession FR801754 [GenBank]
Graphic View Graphic view of sequence FR801754 of line 054C08
Predicted Position of Insertion Chr5:21768086 - go to primer design
BLAST e Value 0.34
Hit Clone Code (BAC ID) MNC6
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit T4L20

 
Sequence (A. th genome BLAST matches underlined)
>59-K012357-022-054-C08-8409
GTGATCCATGTAGACTTTCCTGACATGAGAGCCTTTACATTTGAATATATACTGTACAAC
TACTTAGGTCACGCATATTTGGACAGGCTTGTATGATATGCTGCGTATACCGAGGCGTAT
GTCCTACACAAACGAACGGGTGAAGACGAAATGAATACTTCTACGGAACGCTGCTATAAC
TCTTACTGAATGACCAGGAGTGCTCCTCTACAGAAAAGAAACTGATCATACCGGAATCAC
GCCAATGCTACAAACCTCTACATGGCTCACAACTTAGAGCGACAAAATCATGTACCAATT
GCGAATAACTTATCCGGGTCTGGCGACTGACGGGGCCGACATACTGCATTTCATGGGGCG
GGATGGCACTCTCGTAGATATCCACCCAAGCCAA
GenBank Accession AL754407 [GenBank]
Graphic View Graphic view of sequence AL754407 of line 054C08
Predicted Position of Insertion Chr4:16530330 - go to primer design
BLAST e Value 7e-15
Hit Clone Code (BAC ID) T4L20
Insertion Classification Genome Hit
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL754408 [GenBank] AL754407 [GenBank]


Last Updated on 31.08.2016 09:40