SimpleSearch - Line and FST details


Line specific information

 
Line ID 054D08
Vector Used pAC161
Line Availability only available from NASC (N405132)
Segregation Analysis 100:99:74
Confirmed for Hit At1g14110
Parent of DUPLO pair none
Parent of pair(s) 93419, 93429, 93433, 93436, 93438, 93440, 93441
Note Although the line exists, the insertion in At5g56560 can not be ordered because the confirmation of this insertion failed.

Gene hit At2g01008

 
Sequence (A. th genome BLAST matches underlined)
>60-K012471-022-054-D08-8409
NTGATCCATGGTAGATTTCCCGGACATGGAAGCCTTTACAATTGAATATATCCTGGNCAT
GAATTTGACATACGTGTGTATCCTTGCTACAGGGTTTGAAGAGAAATCTTGCTTAAGTAG
GTATGATCAGTCTATGAGCAAGCCTTCACCATACAAACCATCTATGGGAATCGTGCCTAA
AGCGAAGAAGCTACGATGATGCTCCACAAGCGTGTGCGGGCCTGGCACAAAAGCTTACAA
GAGAGCTACGAAGCAGCTCGGCCACAATGAATGAACCGGCTCTGGAGATGAATGTCGGAA
TGTAAGGTGGATGCCTATGACCGGGCTATGGGATCCTCCCTATTAGTGAGGTTGATGTTA
TTCCGAGAATTAGCAAACCGTAACGAAGATGTTCTTGGCAACCATCTTTTGATGGGAGTC
CGGCTGTTCGATAGCCGGCCAAGGGTGATGAACGAAATGTGAACCCTTGTCTCGCCTAGG
TTGGATGGGCGTGCTTCGTTGGAAAGCATGGATCCGCCTAGGCTGTCCCGAGTGTGAGCG
AGGTGTGAGTGTCGCCCATGGGCATCGACACCTTGCGGCTATGGGATCCTCCTAATAAGG
GAANNNNGAAAAATAAACAAAAATTCCTTNNNTNAAAAAAAATAAAGCCTTTCCTTATAA
AANNCACTTGCTTTCTCCNAAAAATCCACCTTTTACTTTCTTCCATCTTTTATGGAAGGA
CCCTTAAGTTCCAAACCAAACTCATTAAACTATTGCCCACGAAAGAAACCCGGTTTTCAC
CATTTGGGCCGGCCTCCTTTTCCACCCCACAACCAAATT
GenBank Accession BX942860 [GenBank]
Graphic View Graphic view of gene At2g01008
Predicted Position of Insertion Chr2:2357 - go to primer design
BLAST e Value 1e-127
Hit Clone Code (BAC ID) F23H14
Hit Gene Code At2g01008 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification TS2TE (3')
Confirmation Status unknown

Gene hit At1g14110

 
Sequence (A. th genome BLAST matches underlined)
>60-K012427-022-054-D08-8409
GTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGGNCAT
GAATTTGACATACGTGTGTATCCTTGCTACAGGGTTTGAAGAGAAATCTTGCTTAAGTAG
GTATGATCAGTCTATGAGCAAGCCTTCACCATACAAACCATCTATGGGTTCCGCCCTTTA
GCGAGTAAGGCTACCATGATGCTTCACAAGCGTTGCGGGCCTGGCACAAAAGCTTACAAG
AGAGCTACAAAGCAGCTTGGTCACAATGAATTAAGCAGCTCTGGTGATGAATGTCGGTAT
GTAGTGTGGATGCCTATGTTTGGTCTATGGGATCCTCCCTATAGTGAGTCGTATGACTCA
CTCTATGCTCTCTTGACAGATAGAGTCATGCTTGTTGACCAACGGAACGATATAACTGAC
CTCTTCTGCGAGCCTTTCCCCGAAACTTCCTGGTTACTTCCTCTAGATTTTCCATTGAAT
GATCAGTTAGATAGCTTCAACAGGGAACACTCGCGATGTTACGGAACAATGTTGAAGACT
CATGGCATTAACTCAACTTCAATAATACCGTCACATCTTTATCTTGATATTTTCCATGAT
TCCAGGGATCATTGACAAAAGTTCTTTTGTGAAAAAAGATCAAGCTTTCCTTTGAAAAAG
TCACTGGGCTCGGCGGGGGGATCCTTCCCTATAGTGAGTCGTATTTACTTAAGNANNNNC
CGGNGTTTTTCTTAGACACATCTCTTACTGTACCGCCTGAGTAAAATGAGGGGTGTTCCC
GATTTGAAGGTGATGTTGTTGTTGACGCGCCAACAGAATAACTGGGGGTGGTGGGTCGGG
GAATGTTACCAATGGCGATTACTATTAGAAAACAATATAAAA
GenBank Accession BX942859 [GenBank]
Graphic View Graphic view of gene At1g14110
Predicted Position of Insertion Chr1:4830504 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F7A19
Hit Gene Code At1g14110 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation fucosyltransferase 9
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX942857 [GenBank]

Gene hit At5g56560

 
Sequence (A. th genome BLAST matches underlined)
>60-K012454-022-054-D08-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCAGTGTTTGATGCCGCTTAGCACCCGGAGGAGCTTGCATGCTGTTTTCT
ACTCTCATCTGATCCGGTTTGGTTTATCTTTTTCATTGACAACTGAGCCGAGCCACCTTC
CCCCCAAACAGCCAGCGACCGTGCGCCTGTTGATCCACATGGGACTTTTTTACTTCATCC
GTCGAACGGCGTTGCAATAGAAGCGATCCATTCACCATATGGGACGACCCACCGGGCAGG
CGCTCATCGCTATCGCAACATTTTGAACTCTTGTACTGTCGACCCTACGATCGCACAACC
CGGCCCACGACTGAGGCCGGCTCAACCCTTGCGCTCGCTTCATGCATAAGGATGCTGACG
TTCTCTGCAGCACGCTTATCAGAACTACATGCTGACAAATACTATGTTACGCGTCGGCAT
GCCGTCCTGCGCTTGTCCTGTCGTGTTCTACTAAACTGTGATATGCGCCTAGAGTATCTA
CCTTACCACTAAAGCCCGATTAATTACCTCCTTGAACTTTACCGTCACCGTTGGCCTGGC
TGGCTATGGGATCCTCCCTATAGTGACAATATTTCCCTAACCTGGGGAAAACAGGAGCAG
TTTTTGGTTACCTATTGGGAAAACTTTTAGGATTTAATATTTATTCCTAAATTCCATCTA
TTTTAATATCCAAATCCCTAAGGAGTTCAGAGGTTTTGTCCCTATTAAAAAGGTAATAAT
TA
GenBank Accession FR801764 [GenBank]
Graphic View Graphic view of gene At5g56560
Predicted Position of Insertion Chr5:22901565 - go to primer design
BLAST e Value 6e-06
Hit Clone Code (BAC ID) MKN22
Hit Gene Code At5g56560 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation FBD, F-box and Leucine Rich Repeat domains containing protein
Insertion Classification CDSi
Confirmation Status failed, line belongs to a contamination group, please check line 054E10


Last Updated on 07.07.2016 14:03