SimpleSearch - Line and FST details


Line specific information

 
Line ID 054E07
Vector Used pAC161
Line Availability only available from NASC (N405143)
Segregation Analysis 108:81:48
Confirmed for Hit At5g48150
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At5g38430 can not be ordered because the confirmation of this insertion failed.

Gene hit At5g48150

 
Sequence (A. th genome BLAST matches underlined)
>53-K012301-022-054-E07-8409
CACACGAATGGATCTTTAGAAGAATGTAATATATGAAATCACTCTATGGGATCCTCCCTC
TCGAGGCATCCAACCAAGATACAAAGCTCCATCTCTTTCTTCTATCCTGTCCTTGTCTGA
GTTGTTCCTAAGCAGACTTTTAATGGTTGAATTCACCAAGGGACTCACCGGCTAAGGAGT
GATACCCGCCATCCCAGACCGAGACCTCCATTGTCCTAGGAGCTCGTGTCTCTCCACCCG
TGCAGCTCCTTCTCATGCGATGATGTTCACGACGTCTCTTGCTATGGGATCCTCCCTCTC
GTGACGCCTCT
GenBank Accession BX572127 [GenBank]
Graphic View Graphic view of gene At5g48150
Predicted Position of Insertion Chr5:19522431 - go to primer design
BLAST e Value 7e-89
Hit Clone Code (BAC ID) MIF21
Hit Gene Code At5g48150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation GRAS family transcription factor
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX572131 [GenBank] BX572129 [GenBank] BX572128 [GenBank] BX572130 [GenBank] BX572130 [GenBank]

Gene hit At5g38430

 
Sequence (A. th genome BLAST matches underlined)
>53-K012297-022-054-E07-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAGGAAT
TTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGG
TTTAAACTATCAGGAAATCCTTGGATATCGTTCAGGTAGCCCACGCCGCGCTTGAGCGCA
TAGCGCTGGGTTTCCGGTTGGAAGCTGTCGATTGAAACACGGTGCATCTGATCGGACAGG
GCGTCTAAGAGCGGCGCAATACGTCTGATCTCATCGGCCGGCGATACAGGCCTCGCGTCC
GGATGGCTGGCGGCCGGTCCGACATCCACGACGTCTGATCCGACTCGCAGCATTTCGATC
GCCGCGGTGACAGCGCCGGCGGGGTCTAGCCGCCGGCTCTCATCGAAGAAGGAGTCCTCG
GTGAGATTCAGAATGCCGAACACCGTCACCATGCACTTTACTCTTCCACCATTGCTTGTA
ATGGAAGTAATGTCAGTGTTGACCTTCTTAACTGGGAATCCAGTCATGGATTTGAGGCCG
CCGAATGGAGCCACCGCGGCCGATTGCACCGTANAAGCACGGCTGACTGTAGTCACAGCT
GAAGAGGATATCATAGAAGCCATTTTTCTCACTTCTGTATG
GenBank Accession FR801772 [GenBank]
Graphic View Graphic view of gene At5g38430
Predicted Position of Insertion Chr5:15384998 - go to primer design
BLAST e Value 6e-06
Hit Clone Code (BAC ID) MXI10
Hit Gene Code At5g38430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribulose bisphosphate carboxylase (small chain) family protein
Insertion Classification CDSi
Confirmation Status failed
Other FSTs Supporting this Hit FR801772 [GenBank]


Last Updated on 31.08.2016 09:40