SimpleSearch - Line and FST details


Line specific information

 
Line ID 054E07
Vector Used pAC161
Line Availability only available from NASC (N405143)
Segregation Analysis 108:81:48
Confirmed for Hit At5g48150
Parent of DUPLO pair none
Parent of pair(s) none
Note Although the line exists, the insertion in At5g38430 can not be ordered because the confirmation of this insertion failed.

Gene hit At5g48150

 
Sequence (A. th genome BLAST matches underlined)
>05-K029742-022-054-E07C-8409
ATTTACAATTGAATATATNGTCAAAGTCAACTCTTTCCTCAATCAAAATTTAAGTATGTA
GTTCACACGAATGGATCTTTGTAATAATGTAATATATGAAATCAATCTAGTTTCAATAAA
ATTACAAAATAGTCTTTTCATACTTTTGTGACATCGCAGCGACTTCAATAATTTTGAGAG
AGAACACGTGTAAATGTCTCTTTCGCAGTGTGTCTGAATTTAATTTGACACCTACTTTTA
ATCTTTTATATATCATCATTAATAATAATCTTCGACATATATTGATTAGAGGGAGTGGAA
ACC
GenBank Accession HG968660 [GenBank]
Graphic View Graphic view of gene At5g48150
Predicted Position of Insertion Chr5:19522356 - go to primer design
BLAST e Value 8e-157
Hit Clone Code (BAC ID) MIF21
Hit Gene Code At5g48150 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation gRAS family transcription factor
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At5g38430

 
Sequence (A. th genome BLAST matches underlined)
>53-K012489-022-054-E07-35St
CTATCCTTCGCAAGACCCTTGCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGG
GTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGGAAATCCTTGG
ATATCGTTCAGGTAGCCCACGCCGCGCTTGAGCGCATAGCGCTGGGTTTCCGGTTGGAAG
CTGTCGATTGAAACACGGTGCATCTGATCGGACAGGGCGTCTAAGAGCGGCGCAATACGT
CTGATCTCATCGGCCGGCGATACAGGCCTCGCGTCCGGATGGCTGGCGGCCGGTCCGACA
TCCACGACGTCTGATCCGACTCGCAGCATTTCGATCGCCGCGGTGACAGCGCCGGCGGGG
TCTAGCCGCCGGCTCTCATCGAAGAAGGAGTCCTCGGTGAGATTCAGAATGCCGAACACC
GTCACCATGCACTTTACTCTTCCACCATTGCTTGTAATGGAAGTAATGTCAGTGTTGACC
TTCTTAACTGGGAATCCAGTCATGGATTTGAGGCCGCCGAATGGAGCCACCGCGGCCGAT
TGCACCGTAGAAGCACGGCTGACTGTAGTCACAGCTGAAGAGGATATCATAGAAGCCATT
TTTCTCACTTCTGTATGAATTGCAAAGCTGGTACGACGGATCGATCCACGTGTGGAAGAT
ATGAATTTTTTTGAGAAACTAGATAAAATTAATGAATATCCGTGGTTTTGGTTTTTTCCT
TGGGGCCGTCTTTGGTTATATTGAGATTTTTCAATCAGAGCGCAAGACGTGAACCTAGTA
TTCGAGTCAATTTTTATTTTTCTACTAATTTGG
GenBank Accession FR801774 [GenBank]
Graphic View Graphic view of gene At5g38430
Predicted Position of Insertion Chr5:15384688 - go to primer design
BLAST e Value 6e-06
Hit Clone Code (BAC ID) MXI10
Hit Gene Code At5g38430 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Ribulose bisphosphate carboxylase (small chain) family protein
Insertion Classification CDSi
Confirmation Status failed


Last Updated on 07.07.2016 14:03