SimpleSearch - Line and FST details


Line specific information

 
Line ID 054E12
Vector Used pAC161
Line Availability only available from NASC (N405148)
Segregation Analysis 100:100:72
Confirmed for Hit At3g25710
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g25710

 
Sequence (A. th genome BLAST matches underlined)
>93-K012471-022-054-E12-8409
TTTGATCCATGTAGATTTCCCGGACATGTAAGCCTTTACAATTGAATATATCCTTTGGGA
CTGCTTGGCATGTTCGGCGATTATGACTTCTGTTCACTCCTACCCAACGCTCCTAGAGCC
TGACGACGGAACAGCCTTTCAGAAAAGATCCCTTGGCTCGTTCTGGGACGGATATGGGAT
CCTACCTATAGTGAGTTGTTGTTGCTTTTTAATAAAGAGAGTAGTAGTAATTGTTCTTTT
TCTGATAAATATAATACTAATTATTCAGTTTCAAAAATGATAAGTACTATATTTTTCAAT
ATTATCAATTTTATCTATCTCTGATCAACTATTATCGTTTAATAGTTGTAAATTTTCAAA
TTTAAAATAAATGTATCAAATCGATATTTTTGGGTAGTAATTATAGTCCACAGATGGGGT
ATTTTTTGACTATGGGATACTACTGAAGAAGAAAAATTAGCAGAATTAATTCCTTATGAT
TCCCTTTGGGTTTTGTATAGAACGGCAAAACCTCTTTTGCTATTTGGATCCCCCCTCTTG
CGGGAGCGCACGCCCCCAACTTCTATTTCCGAACCTCCTGTTTGCTCTTAATACTTATCC
TTCCCCATCCAAATCCTTCTTTCACTACCCCTTCTTGTCCTATTCGAGTCTCTCCTCCCA
CCATGGTAACATTTATATTAGTTCCGTCGCCTCACTCCACCCGCACTACTACAACACACC
CCATTCTTTACGACGCCGCCTTTCCCCTTCTCCCGCCGCCCATGTCTCCTCTTCTTCTTC
TCTTTCCT
GenBank Accession AL754490 [GenBank]
Graphic View Graphic view of gene At3g25710
Predicted Position of Insertion Chr3:9370248 - go to primer design
BLAST e Value 6e-111
Hit Clone Code (BAC ID) K13N2
Hit Gene Code At3g25710 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation basic helix-loop-helix 32
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL754488 [GenBank] AL754488 [GenBank]


Last Updated on 31.08.2016 09:40