SimpleSearch - Line and FST details


Line specific information

 
Line ID 054G08
Vector Used pAC161
Line Availability only available from NASC (N405168)
Segregation Analysis 134:109:98
Confirmed for Hit At3g25840
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit F5J6

 
Sequence (A. th genome BLAST matches underlined)
>63-K012471-022-054-G08-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGCACGA
CTAGTTGAGGACTCCATCCTAGACAGGTGGCGACATCTCTGTATGTCTGGCGTTCGATAC
AGCATGCTTTTTAACGACTGCCGGGCCCCGTGTAGTACAGGGTTTCACTCAGGAGATGTA
GAGATATTACTTCTATGTAATAACTCTCTCTGCCTTGAGAGCCCAATATCGTTTCGCTAT
GGGATCCTCCCTATAGAGACTCCCTATAGGGAAGNGTCTTATGTGGGGCATACTTTATCC
GCCGTGTCTAGGCTCGACCATACCACAATCGCCTACGCCATCACTTATAGGACCCACCTC
ATACAAAAATATGGTGACCCCTTTATGGAGTGATGTAAATAAGAGCATTCCATGACGGGG
TCGAATCTCATAACGCTTAAAGGTATGTGGATTTTTCGAATTTTGGGCCGAACTAGAAAA
GCCTGATTGACGTGCCTATATACGTGTATAAGAAAGATATTCCTAAGAAGATATTTTCTA
TGTTTTAGATTCGAAAGAACTTAGCCATGTTCTCGACCATACCCATTACGGCTAAAGATA
TTACCAAGATATTCTCCACTTGGTCTATATCGGAGACCATCCATCTTCACTCTCAATTCC
CAACAATTAGATCGTAGATCTCCTTACCAAGGATGTCAATTAATTCCGCATATTTATTTC
CTTGGTAACTATTTCCGACAGAGGGAGGTCCCCTCTC
GenBank Accession AL754551 [GenBank]
Graphic View Graphic view of sequence AL754551 of line 054G08
Predicted Position of Insertion Chr2:7525950 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F5J6
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At3g25840

 
Sequence (A. th genome BLAST matches underlined)
>63-K012301-022-054-G08-8409
CCTGCACGACGAGTGGAGGACTCCATCCTAGTAGGATTCCCGCCTATACGGACTCTCCGT
CAACAGCTGGCAGTCTAACGAAGGCCGTGCCCGGAGTAGATCTAAGTCACATGATCGGGA
GAGAGAAACTTCTATGGGATCGTCCGTGGAGGGAGAGTTTTCGGTCTGTGGAAGACCTCC
TGATTCTATGGGAGCCTCCCTG
GenBank Accession BX649677 [GenBank]
Graphic View Graphic view of gene At3g25840
Predicted Position of Insertion Chr3:9456642 - go to primer design
BLAST e Value 1e-31
Hit Clone Code (BAC ID) K9I22
Hit Gene Code At3g25840 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein kinase superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX649678 [GenBank] FR801802 [GenBank]


Last Updated on 14.10.2014 10:23