SimpleSearch - Line and FST details


Line specific information

 
Line ID 054H07
Vector Used pAC161
Line Availability only available from NASC (N405179)
Segregation Analysis 100:98:94
Confirmed for Hit At2g17370 At2g28030
Parent of DUPLO pair none
Parent of pair(s) 9564, 97003

Gene hit F24D13

 
Sequence (A. th genome BLAST matches underlined)
>56-K012427-022-054-H07-8409
TGATCCATGTAGATTTCCCGGACTTGTGTCTTACTCAGTCATCTGCACTAAAAGTCTAAA
GCATAAAATCCTATGGGCTCTCTCTTCTTCTCTCTTTGGGTGCTATTCTATACTACCACT
CACCATTTAATACTTGAGACCTAACCTAAGACTATCAGCACTGAAACTACTTTCTAACGG
TCTGATGTCACGATAGATTATCTATGGAATCCTTGCTTATTTGGACCATTTTATTGAATT
TTTTTTTCTAATTAAGACTAATATTCGCCGAAGTAATTTAAACTGTTCGTTTTGCAAATT
TGAGGCTATGGGATCCTCCCTATAGTGAGTCGTATTACTAAACCCCATTGGCTTATTATA
TACTTCAAGAGAGTAAAAAATACAGTGAGTCCATGTACTGAATAGAGGCGCGGTGATATG
ATCCTTGACGCTGACGACTAAACTGCCTCTTAGGAAAACTCTAACACCATTGCCTCGGTC
AATATCACTCCACAAGCGGTTTGGTCGTCACGGCTCTGTTAGCGATTGTTTATGTTACAA
CCAGCCGACATCCTCTGTTTGTTCT
GenBank Accession AL754589 [GenBank]
Graphic View Graphic view of sequence AL754589 of line 054H07
Predicted Position of Insertion Chr2:11967782 - go to primer design
BLAST e Value 3e-26
Hit Clone Code (BAC ID) F24D13
Insertion Classification Genome Hit
Confirmation Status unknown
Other FSTs Supporting this Hit AL754591 [GenBank] AL754589 [GenBank]

Gene hit At2g17370

 
Sequence (A. th genome BLAST matches underlined)
>56-K012480-022-054-H07-8409
TGATCCATGTAGATTTCCCGGCTTCGTGTATTACTACAGCATCATGCACTAGAAGTCTAG
AACATAAAATCCTATGGGATCCTCCCTATAGTGACAAAAACCATAACCCTAAATAATCAT
CCCAAAAGTGGAAATAATAAAAGAAGCAGTTAGATTGTGACGGAGGAGACAAAATCATCA
TCTCTGTTCTTCTTCTTCTCCTCTCTCACATACGATGATGACCCAACAACCTTGACGTTG
ATTTCGATGTCACACACAACACTATAAATAACACTCTTCACCTATTTTTGTCATCTCACA
CTTTGGACTTTGGAGCCCAAAATAATCTCATAACCATTAAAAACAAATCTCCTCCTTCTC
TCCGGCGTCAATGGAGGATCTCCGTCGTAGATTTCCGACTAAAAAGAACGGAGAAGAAAT
CTCTAATGTCGCCGTCGATCCTCCTCTTCGTAAAGCCTCTGACGCGCTTCCTCTTCCGTT
ATACCTAACCAACACTTTTTTCCTCTCGCTCTTCTTCGCTACTGTTTATTTTCTTCTTAG
CCGATGGCGTGAGAAGATCCGTAACTCGACGCCTCTTCACGTCGTTGACTTATCTGAGAT
CTGTGCTCTAATCGGTTTCGTTGCTTCGTTTATCTACCTCCTTGGTTTCTGTGGGATGGA
TCTCATTTTCCGATCTTCTTCCGATGATGATNGTTGGGGTAACGATGGGATGATTCCATG
TAATCAATCCCTA
GenBank Accession AL754592 [GenBank]
Graphic View Graphic view of gene At2g17370
Predicted Position of Insertion Chr2:7549695 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F5J6
Hit Gene Code At2g17370 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation 3-hydroxy-3-methylglutaryl-CoA reductase 2
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At2g28030

 
Sequence (A. th genome BLAST matches underlined)
>56-K012297-022-054-H07-35St
TGACGTAAGGGATGACGCACAATCCCCTATCCTTCGCAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGACTGTGGTTGACCCTGCTTC
GCTTTATACTCTGGGAGTCCTAGTACACTCCTTTCTCTCATGGTTTGACCTTACATGTGA
AGACGCTGATTCTCTATGACATCACTATCGTACGGTGAGTACCCATGCTCAATGTCTTAC
TGTTTTGCTAGTCAAGGAACTAGTAAGATCAATTTTGGAACAAATGCTATTGTTGCAGGA
GATGGGGTTGTATCAACCACTATGTTTCTCACGACGGCGAAACCAGGTTTATATTACCTA
AATCTATGGGATCCTACCTATAGCGACTCCATTGACTGAGCGGCGGGAGACGACAAACTT
GCGATCGATGCCTCGTATTTATCGACTCTGGAACCACTCTAACTCTACTTTACTGTGAGC
TACTGCTGCCTATGGTACACTCCCTTTCGTGAGTACTTCCACGTCAGAGCTACCAATTCA
GTGTAGCCCATTACCTTACATAATTCACTCAAATGCTATGGGATCCTCCCTATAGTGAGT
CGTTTAACTC
GenBank Accession FR801808 [GenBank]
Graphic View Graphic view of gene At2g28030
Predicted Position of Insertion Chr2:11934874 - go to primer design
BLAST e Value 4e-72
Hit Clone Code (BAC ID) T1E2
Hit Gene Code At2g28030 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Eukaryotic aspartyl protease family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR801808 [GenBank]


Last Updated on 31.08.2016 09:40