SimpleSearch - Line and FST details


Line specific information

 
Line ID 054H11
Vector Used pAC161
Line Availability only available from NASC (N405183)
Segregation Analysis 100:98:97
Confirmed for Hit At3g51520
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g36290

 
Sequence (A. th genome BLAST matches underlined)
>88-K012297-022-054-H11-35St
TTGACGAAGGGATGACGCACANTCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCG
GTTTAAACTATCATTTCATTTCATCATACTCATTTACTCTTCCAAGGTATCACTTCTGGC
TGCTAAATTGAGCCTATGGGATCCTCCCTATAGTGAGTCGTATTACTCACTCANGAAAAC
ATTTGGAACAGGAACTTTTCTTTGCAGCTAGCTAAACCAAATTCTTCTATTCCACATTGG
CTCTTTGCGGATGATACCCTTGCAAAACAGATGCGGAGGAATGTAAAACGGTGATGGGTG
TTGTTATAAATAATAGTAAGAGCTGTAGGACAAGAAATAAAGTCCAATTACTCATCGGCC
TTGACTGGTAAGCGCGTTGCAAAGAACAGATTATATAGAAGAACTGGNAAAGTACCTTGG
AATTACTAAGGAATGTCTAACGGCTACCTATTAAGTATACTA
GenBank Accession AL754609 [GenBank]
Graphic View Graphic view of gene At1g36290
Predicted Position of Insertion Chr1:13643963 - go to primer design
BLAST e Value 2e-61
Hit Clone Code (BAC ID) F15C21
Hit Gene Code At1g36290 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation  
Insertion Classification TS2TE
Confirmation Status unknown

Gene hit At3g51520

 
Sequence (A. th genome BLAST matches underlined)
>88-K012301-022-054-H11-8409
TTAACAAAGGCTAACCTTTCCCAAACTCCGTTAGGCAATAATTATACGGGTAAATGAAAA
GAATGAACCTTGCGGGCTCTTTAAAGATGGGTTGTTGATAAAAAGTTGGGGAGTTAAAAG
ATTGGTTATTTGGGCTCTCGCACTCAAGAGACGAGAGAACGATAGATAGATCTGAGTAGA
ATCTTCGATTCATTATCTCGATAGTCGTCTTTCATCTGTGAAGAAGCGGACAAACCAAAG
AATCCACCGGAGCTATGGGATCCTGCCTATCTCGATATAGNGANNNNGNNGNNCNNNNCN
NNCNNTNCCACTCTNTCNTCGCCTTGGCCCTCTGGCTTGGCGCCCTTCCCTTCCGCGTCG
CTCTTGTTCTCTGTTCTCTCCTTTTCCTTCCTCCTTCTCTCTCTCTCGTGTCTCTCCCTC
CCCTCTCTCTCCTCTCTCTCTGCGCCGCTGCTCCCCGCTCTCTCCCCTTTCTCTCTTCTG
CCCTCCTTTGGTTTTTCTCCGCGGCCTTGGGCCTTGCTTCTCCTCTGTTTCTCTTTCTCC
CCTCT
GenBank Accession AL754610 [GenBank]
Graphic View Graphic view of gene At3g51520
Predicted Position of Insertion Chr3:19110473 - go to primer design
BLAST e Value 2e-67
Hit Clone Code (BAC ID) F26O13
Hit Gene Code At3g51520 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation diacylglycerol acyltransferase family
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL754616 [GenBank] AL754616 [GenBank]

Gene hit At3g22270

 
Sequence (A. th genome BLAST matches underlined)
>88-K012480-022-054-H11-8409
TTTGATCCATGTAGAATTTCCCGTACATGAANGCCTTTACAATTGAATATGCAAGGCTTG
TGGCCTGCGGACAGATGGAAGTGTAATTTTACCAAGAGCATCTACATGAACTTGTGGATG
CTGGACAAAACTATTACGGTACCTAGGCTGGGGGTCCTTCAGCTGAGCAGGATATAACTG
ACAGATGGCTTTATATACGTCTACTCTTAGGACGCTTTACTATGCAGAAATAATAATGAC
ACTCAGGATTATCTCTGTGTGAATTGGAATGCTCGTATCTTTATTATACTCTCTATTTCC
TACGATATCATGCCCTTTGATCTACACTGCTGTCCAGTTCCACTTATCTAACTAGTGGGA
TCCTTCCTATAGTGAGAATAGACTGAATATACTATGCGTTTAAACTCATAGATCCAAACC
TCCACACTATGGGATCCTCCCTATAGTGTAAANGANCTTGCTCCTTCTCTATCTCTCATG
TATATACATATCCTCTCTCTATCTCT
GenBank Accession AL754615 [GenBank]
Graphic View Graphic view of gene At3g22270
Predicted Position of Insertion Chr3:7876883 - go to primer design
BLAST e Value 2e-46
Hit Clone Code (BAC ID) MMP21
Hit Gene Code At3g22270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Topoisomerase II-associated protein PAT1
Insertion Classification CDSi
Confirmation Status unknown
Other FSTs Supporting this Hit AL754614 [GenBank]

Gene hit T6A9

 
Sequence (A. th genome BLAST matches underlined)
>88-K012357-022-054-H11-8409
GTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATAGTTCTCGCTTCG
CGCCTGCGGACAGAAGGGAGTGTCACTTTACCAAAATCCTATACGTGAACTTGTGGATCG
CGGGACCAAGCATATACGGACCCTTGGCTGGGGTCTCTCAAGAAGGACTGGATATAACAG
AGCACGCTTGGTTAATATACTCTTACGTTGAACGAACGCCTCAAGTGACAGAAAACACTA
ATCACCTCACGGTAAATATCTTGTGATAATTACACGACATCCGTCTTTCATGTAGCAGAA
TTCCCCCTAGAATATGATTCCCATGGATCTACGGGACTCTCCGATTCTTCTTATAGAGAC
TCTGGTGTACTCACTATAGTGAGACGATCCACACAATAATATGCGTTTAAACTCATAGAT
CCAAACCTCCATACTATGGGATCCTCCCTATAGTGAGTCGATTTACTC
GenBank Accession AL754611 [GenBank]
Graphic View Graphic view of sequence AL754611 of line 054H11
Predicted Position of Insertion Chr1:484467 - go to primer design
BLAST e Value 3e-14
Hit Clone Code (BAC ID) T6A9
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40