SimpleSearch - Line and FST details


Line specific information

 
Line ID 055A02
Vector Used pAC161
Line Availability only available from NASC (N405186)
Segregation Analysis 129:124:102
Confirmed for Hit At5g56600
Parent of DUPLO pair none
Parent of pair(s) 743

Gene hit F10C21

 
Sequence (A. th genome BLAST matches underlined)
>09-K012479-022-055-A02-8409
TTTGATCCATGTAGAATTTCCCGGACATGAANGCCATTACAATTGAATAAATCCGAGAGG
ACGACTGCCCCATATACACAAAATAAAAAGATCTTGGTGCGTAATCATACCAACAATTAC
AAGATGTCTGGCTTCAACTTTAGAACAGATACGCATGGGATTCGTGCCTATTGAGAGCGA
CCTATGGGATCCCCCCTATTTTAAATACAGAAGATTAAAAAATAAGATCAAAATATAGTA
GACCTCATTGTCTAAATCCAAACCAGCATGTCATGCAACCATCACATCTTCTATCCCCTT
GGTTTTGAATGGATGAAATTCTATTTCTAACTTGCTTATCAAGAAAGCGAGTCAATTGAG
CTGCGGGCTGTGGCACTTCTCCATGTCGACGGCCGTTTCACTCTTTCCGTATATAGTGTA
AAGTGAGCTGAAAAGTGTATCTCGTAAAGAACAGGAGCTCATGTCCGAGCTATGGGCCGT
GGTCTCACTATGGGATCCTCCCTA
GenBank Accession AL754624 [GenBank]
Graphic View Graphic view of sequence AL754624 of line 055A02
Predicted Position of Insertion Chr1:12166228 - go to primer design
BLAST e Value 4e-152
Hit Clone Code (BAC ID) F10C21
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At5g56600

 
Sequence (A. th genome BLAST matches underlined)
>09-K012426-022-055-A02-8409
TGATCCATGGTAGATTTCCCGGACATGAANGCCTTTACAATTGCATGTGCGGAGAGGCGG
TTGCCTGCCGCATCGCACATTAAGTGATCGCCCACGTAAGTCTGCCCGACATGTCTGTTT
TCTTCTTCTTCTTTACTTTAGCTCTGCTTCTTCTTTGTGGGTTATCGGACTGTTCTATGG
GATCCTCCCTATAGTGAGGCGTAGTTACTCAATTTTCTGATTCATATGTTCTTGAGGTTA
TAGAGTGCAAAAGATGCATTAGAAGAAGTTCGAATCACAAGTTTAAAGCTCTTTTAAGAA
GAAAGTTTTGACCTTTGGAAATAGACAAGTTCTTTGTACTGGTTATGTTGTTCATAAGTT
ATTAAGTTGCTTTCATGAGATGTTTAAGAGAGACTGAATCTGTTTCTCTTATAGTTTTTG
TATTGTTGTTGTTTTAGGTGAACCCTGAGGAAATTCAGGGCATCAAAGACGATTCTACTA
CACCTGGAACACTTGCCCCCACAGGATTGTTCCTTGGTGGAAACAACTTCATGGTCATCC
CAGGAGAGCCCTATGCCGTCATTCCAGGAAAGAA
GenBank Accession BX649680 [GenBank]
Graphic View Graphic view of gene At5g56600
Predicted Position of Insertion Chr5:22910599 - go to primer design
BLAST e Value 8e-178
Hit Clone Code (BAC ID) MKN22
Hit Gene Code At5g56600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation profilin 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03