SimpleSearch - Line and FST details


Line specific information

 
Line ID 055D07
Vector Used pAC161
Line Availability only available from NASC (N405227)
Segregation Analysis 50:46:31
Confirmed for Hit At1g35510
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g35510

 
Sequence (A. th genome BLAST matches underlined)
>52-K012356-022-055-D07-8409
TTGATCCATTGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATCTCTGTGGCCT
ATGTTTACTCTCTCTGTGATCGAATGGTATGTCTCGTTTCTTGATGTAGATATGTGATGC
AGTTGCTGTGGCTGGACTGCTGAATGCTACTCTTGTCATTCCGATTTTTCACTTAAACAG
TGTATGGCGTGATTCCAGGTTACTATTGTGGTTTCTAATCTTCAGATCAAGTTGCTATCT
TTGGCAGCATGGTTTACTTACAGATTCCTTTTGCTTTTTCCTATTTTGGGTTGGTTACAG
CAAATTTGGTGATATATTTGATGAAGACTTCTTCATATATGCTCTTAGTAAGAATGTGAA
TGTTGTGAAAGAGCTCCCAAAAGATGTACTTGAGCGATATAACTACAATATAAGCAGTAT
TGTTAATTTGAGATTAAAAGCTTGGTCGAGTCCAGCGTACTATCTCCAGAAGGTGCTTCC
ACAACTTTTGCGTTTGGGGTATGCCATTCACTGACGTTTTCTTTTTCTATTTAGTTGTCT
TAGTCTTGATAGTTAACATGCAAAATGACATGGATTGATAGTAAGGTAGAGAACTATGGG
ATCCTCCCTATAGTGAGTCTTTTTAC
GenBank Accession AL754736 [GenBank]
Graphic View Graphic view of gene At1g35510
Predicted Position of Insertion Chr1:13072143 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F15O4
Hit Gene Code At1g35510 [TAIR] [MIPS] [SIGnAL]
Gene Annotation O-fucosyltransferase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit At3g03440

 
Sequence (A. th genome BLAST matches underlined)
>52-K012296-022-055-D07-35St
TGACGTAAGGGATGACGCACAATCCACTATCCTTCGAAGACCCTTCCTCTATATAGGAAG
TTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGG
TTTTCCGGGAACATGCCGTTGGCGTGCTTTTAACGCTCTGTCAAAGCGATAGGAGTAAAT
ACAGAGAGCCAATTCTTAGAGAATGTGTAATACCGGGACTGCTTGAGCTCACGGTTCAGG
GGACATCCAAATCTCGGATTAAAGCTCAAAGACTTCTCTGTTTACTAAGGAACTCGGAAA
GCTCGAGATCATATGTCCAACCCGATACAATAGAAAACATAGTGTCAAGCTTAATCTCTC
ATATCGACGGAGATGATCACTCCGGTAAAGCAAAGAAGATGCTATGGGATGCTCCCTATA
GCGAGTCGTATTAGCTAACGGGCCCCCCCTCGAGGTCGATCCAACCCCTCCGCTGCTATA
GTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGACATGTCGCACAAGT
CCTAAGTTACGCGACAGGCTGCCGCCCTGCCCTTTTCCTGGCGTTTTCTTGTCGCGTGTT
TTAGTCGCATAAAGGAGATTACTTGCGACTATGGGATCCTCCCTAAGTGAGGCGTTTTAC
T
GenBank Accession AL754735 [GenBank]
Graphic View Graphic view of gene At3g03440
Predicted Position of Insertion Chr3:818212 - go to primer design
BLAST e Value 2e-132
Hit Clone Code (BAC ID) T21P5
Hit Gene Code At3g03440 [TAIR] [MIPS] [SIGnAL]
Gene Annotation ARM repeat superfamily protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 14.10.2014 10:23