SimpleSearch - Line and FST details


Line specific information

 
Line ID 055E10
Vector Used pAC161
Line Availability only available from NASC (N405242)
Segregation Analysis 100:98:82
Confirmed for Hit At1g01580
Parent of DUPLO pair none
Parent of pair(s) 96841, 96844, 96846, 96848

Gene hit At1g01580

 
Sequence (A. th genome BLAST matches underlined)
>77-K012479-022-055-E10-8409
TCTTCTCCTTATCTTCGGATATGTGGTGGCCCACATACAAGTCCGGCCGCCAGAGCTATC
TCTCCGGCCAAATTTGAGACACCTTTCGTATCCCACATGATCATCTGCCATTAATTTATT
CCACGTCAGATTATAATATACTATACCGTTTAAATTACGATTCTTGTACCCCTATGGGAT
CCTCCCTATAGTGAATGGAGCTCACTTTCTCCAAAAACTCTATGGGGTACTTTCTGTCCA
GTCGGCTAGTTGTAGATGAAAAGTTCACCCTTACTGGATATTGATCTGAGTGTAAACTAT
TCTTTCTGTTTTATACAGCTGGTTTATAGCCCGACGAGCATAATGTTTGTGAGCATACCG
AGCATTTCAAAGCTGCAATGGCATCCGTTTACGATAACTTCCAGTATGAAACTCGAACCA
GAGAAGCTGAGTATTGTTATCATGAGAGATAGCACATGGTCAGCTAAGCTTCACCAGAGG
CTTTCTTCTTCTGATCAGATCGACCGACTTGCTGTTTCTGTAGAAGGTCCTTACGGCCCT
GCTTTCGGCGATTTCTTTAAGTGATTTGTTTATATACCCTTTCTAAGTCACCTATCTAAT
AACTTTATATTCAGA
GenBank Accession CR356259 [GenBank]
Graphic View Graphic view of gene At1g01580
Predicted Position of Insertion Chr1:211202 - go to primer design
BLAST e Value 1e-164
Hit Clone Code (BAC ID) F22L4
Hit Gene Code At1g01580 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ferric reduction oxidase 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit FR801872 [GenBank] FR801872 [GenBank] FR801873 [GenBank]

Gene hit MNC6

 
Sequence (A. th genome BLAST matches underlined)
>77-K012296-022-055-E10-35St
GTGACGAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAGGAAG
TTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATAGTCACATATTCAATTGTA
AATGGCTTCATGTCCGGGAAATCTACATGGATCAGCAATGAGTATGATGGTCAATATGGA
GAAAAAGAAAGAGTAATTACCAATTTTTTTTCAATTCAAAAATGTAGATGTCCGCAGCGT
TATTATAAAATGAAAGTACATTTTGATAAAACGACAAATTACGATCCGTCGTATTTATAG
GCGAAAGCAATAAACAAATTATTCTAATTCGGAAATCTTTATTTCGACGTGTCTACATTC
ACGTCCAAATGGGGGCTTAGATGAGAAACTTCACGATCGATGCCTTGATTTCGCCATTCC
CAGATACCCATTTCATCTTCAGATTGGTCTGAGATTATGCGAAAATATACACTCATATAC
ATAAATACTGACAGTTTGAGCTACCAATTCAGTGTAGCCCATTACCTTACATAATTCACT
CAAATGCTATGGGATCCTCCCTAT
GenBank Accession FR801871 [GenBank]
Graphic View Graphic view of sequence FR801871 of line 055E10
Predicted Position of Insertion Chr5:21768086 - go to primer design
BLAST e Value 0.35
Hit Clone Code (BAC ID) MNC6
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 31.08.2016 09:40