SimpleSearch - Line and FST details


Line specific information

 
Line ID 055F04
Vector Used pAC161
Line Availability only available from NASC (N405248)
Segregation Analysis 50:49:39
Confirmed for Hit At1g08450
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g08450

 
Sequence (A. th genome BLAST matches underlined)
>30-K012356-022-055-F04-8409
NTGATCCATGGTAGATTTCCCGGACATGAAGCACTTTACAATTGAATATATCCTGATGAA
GTGAGAAATTCTGAAAAATGGGATTACCTCAAAATAAGCTCAGTTTTTTCTGCTTCTTCT
TCCTCGTCTCTGTACTAACTCTTGCCCCATTGGCTTTCTCCGAGATCTTCTTAGAGGAGC
ATTTCGAAGGTGAAGTATATATATAAACACTCTTCTCTCTTTTTTTTCCTTTTCTGGGAA
ACAAAACAACGATTTGTTATTTTTGTTTCCTTTTTGAATATATTGCTATGATTAGTAAGT
AGTAACTTTCCTTGGTAGATTTTGATTTGATTAGGATAGTGAATCCGAATCCATCCTTCA
CTATGGGATCCTCCCTATAGTGAGTCG
GenBank Accession AL754810 [GenBank]
Graphic View Graphic view of gene At1g08450
Predicted Position of Insertion Chr1:2671824 - go to primer design
BLAST e Value 7e-89
Hit Clone Code (BAC ID) T27G7
Hit Gene Code At1g08450 [TAIR] [MIPS] [SIGnAL]
Gene Annotation calreticulin 3
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23