SimpleSearch - Line and FST details


Line specific information

 
Line ID 055G07
Vector Used pAC161
Line Availability only available from NASC (N405263)
Segregation Analysis 50:47:37
Confirmed for Hit At3g13160
Parent of DUPLO pair 2260
Parent of pair(s) none

Gene hit At3g13160

 
Sequence (A. th genome BLAST matches underlined)
>55-K012470-022-055-G07-8409
NTGATCCATGTAGACTTTCCCGGACCATGAAGCCTTTACAATTGAATATATCCTGATTTA
CCTAATTTGAAGTATTAAAGCCGCTCCCCTGACTAAAAACCTTTGAACACTCCGATCCAA
AAGAAAGAAGAGAAAAACCTTTGCTTACAGCTAAAAACGATGGGGTCTGTCTCTGGCTTT
CTCCTTGGGGGCAACTTCAGCTTCAGCACCCACACGAATCGCCGTTTCTTCGTCCGCCGA
TACCGGTGGTGAAGCCACACCCTCGCCACCCAAACCGTCCCTGATGACCCTCGAAAATGA
CGAACGCGACCCCAAATTCATCACGGAAAAGTTCAAGAAAGCCTGCCAAGCAGAGGGGTT
CCGGAAGAATATACCTGCTTATGAGAGAACCGACCGCCGTCTGGCCGAAACCAAGAAGTT
TGAGTGGGTCGAGGAGATCCTGGAGGACCATAACAAGTATCCAAACATGTCAAAGGAAGG
ATTCGTGGCGAGGATTATCAATCTCTATGGACGAGTCGGTATGTTTGAGAATGCACAAAA
AGTGCTCGACAAAATGCCTGATAGAAACTGCAAGAGAACAGCGTTGTCTATCAACGCATT
ACTGAATGCCTGAGTGAACTCCAAGAACTCTGATTGGGTTGAAGGCATCTTCAAGGAGGT
GCCAGGTAAGCTCTCATACCAAAAAAAGGGGCCATTCTAACATTACTTTGATCAAGGGAT
TGTGTGGAAAGGGTTCCTTCACTGAAGCTGNTTGCGTGATTGATGAGATTGAAACCAAGG
GTTTGAAACCTGATCATATCACCTTCAATATACTTTACATGAGTCGTAT
GenBank Accession AL754855 [GenBank]
Graphic View Graphic view of gene At3g13160
Predicted Position of Insertion Chr3:4231279 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MJG19
Hit Gene Code At3g13160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Tetratricopeptide repeat (TPR)-like superfamily protein
Insertion Classification TS2TE (5')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL754854 [GenBank]


Last Updated on 07.07.2016 14:03