SimpleSearch - Line and FST details


Line specific information

 
Line ID 055G12
Vector Used pAC161
Line Availability only available from NASC (N405268)
Segregation Analysis 100:97:94
Confirmed for Hit At1g50325 At3g03920
Parent of DUPLO pair 998, 11985
Parent of pair(s) none

Gene hit At1g50325

 
Sequence (A. th genome BLAST matches underlined)
>02-K119971-0022-055-G12C-8409
TCATGAACTCATAGCAAAATGACTCATTGACTGCTCTGCGTGCGCACATGCCACATATTT
CATCTGTTGTAACCTTCGTATTAAATCTTGCATATGATGAGACAACAAAAAGAAGTAAAA
CTACTATATGAACCAATAAAAAGTTGTTCTTGACATATGCAACCATTTTTGTTTTTCAAT
CTTTAAGAACTTATGTGAGATTATTATAGGGTGCAAACATATCTTTAAATTTAAAACTAA
CAGATTTTGTTTCATTTTTGCTGTAAATGCTGCAGATTATGTACCATGGAAAAAGATTTG
AATTTAAATCCAAAAATATGACTATGATTCTCCTATTTTTGTTTGATTTTTTTCCTCATT
GTTTTTTTTATTTTATTTTTGGACAATGTTTGTTTTCATTCCATAATGTAGAAGCCAAAT
ACAAAGATAAAGGGAAAAAGTTCCAAAGTTTAAAGCACAACAATAAGGGGCATACTCCAA
AAGTTACCAGAAAAATGATAAAAAGATAGATAGGGCTAATCGACAAAGGGTCCTTGAGAG
TTTTGAGCCAAAAGCAAAGATGCTTATGGTACTTGTGAGATCAAAGTTTATCGACGACTC
TNTCAAGAGCGATTCAAAGGAAAAACAAATTGTCTCTGTCAAAAGACGAAGTGGCGTTAA
TGAAGGGGTCAAAGACATGATTCTCGCCGGCACGAGGAGAGCTACATGAAGTAGAGCTTT
GACAAAGGTTTGGGTAGTGGTGATGGTGCTCTGGTGCTTGGATTTATTTGCTAGAATTGA
TGCCGAAGAAAGTTGAAGTTAGGCAAACAAT
GenBank Accession LN713385 [GenBank]
Graphic View Graphic view of gene At1g50325
Predicted Position of Insertion Chr1:18640314 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F14I3
Hit Gene Code At1g50325 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Plant invertase/pectin methylesterase inhibitor superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL936430 [GenBank]

Gene hit At3g03920

 
Sequence (A. th genome BLAST matches underlined)
>95-K012300-022-055-G12-8409
TCTACTACCTATTGGAGCACCTTTACCTCTACTAAATGATCCACCTCTTCCACGACCTCT
ACTATCACCTCTTCCACGACCTGCACCTCCACGTCCACCCGTTGACTGACCCCTGGAAGA
ACAAAGACACGCATTTAGATGGAGTTTGATACAATTAACAACTCTCAACTAATAGTGTAT
CTAAAGTCTCGATTGTTAAGAGGAAAAAGCTAATTGCTAAAGTTAAACGAGCTCACTAAT
GTTATTTCAAGTTCAGGAAAAGAAACTTATATATTGACCAATGATGTGTTAAGAAGTGGG
GCTTACTTTGGCTGAGGAAGGAATCGAGCGAGTGGCAAAAGCTTGTAAGGGTCGATGAAG
AACTTATCTCCTGGAGAATACGAGGTGGCTACAATACCTTCCATCATTTTGATAGAAAAC
AACTGAAGAATAATCAAAACAGAATTAATGTCACAAACCTCTAGGTTGCTTACCACTGAG
AGAAGAATAGAGAACTTACAGATTCATTAATTGGGCCAAAGATTTCATCTACTTTCCCAA
TCTGAGTCTTGATCTCTA
GenBank Accession AL754872 [GenBank]
Graphic View Graphic view of gene At3g03920
Predicted Position of Insertion Chr3:1009177 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F20H23
Hit Gene Code At3g03920 [TAIR] [MIPS] [SIGnAL]
Gene Annotation H/ACA ribonucleoprotein complex, subunit Gar1/Naf1 protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit BX530755 [GenBank]


Last Updated on 14.10.2014 10:23