SimpleSearch - Line and FST details


Line specific information

 
Line ID 055H05
Vector Used pAC161
Line Availability only available from NASC (N405273)
Segregation Analysis 100:99:74
Confirmed for Hit At5g15320 At5g15340
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g15320

 
Sequence (A. th genome BLAST matches underlined)
>40-K012426-022-055-H05-8409
TGATCCATGTANGATTTCCCGGACATGAAGCACTTTACAAATAATATAGTGTCCTATTTA
TACTACGATTACATATTTATTATTTCATTATGAAATATTGGCTTGGTCTTTTTTTTCGGC
TTTTGTGTTTCTTATATTATTTTCACAATTAATATGAAAAAAATGAAAAATCGGATTCGA
GAGAGAGAGGCAAAGCCCAAGGCAGAAAAGGACATGAAACAACCAACATTTAATTTTCTC
ATATAGTAATCGACATGTCAACGTGTTGTTTTTATCACATCCACATTATCATCATGTAAC
TCTCAATCTTTCACATTTCTTACGTAGTTAACAAAATAAAATAAAATAAAATTGACCACA
GTATATGTATACTTTCTATGGGATCCTCCCTATAGTGAGTCGATTTNACTCANNNGNNNN
ANNNNGNNNAANNNGGANCGNACAAAAACTGGGNNCAAGATAGATTTTTTTAATCCGGGG
GACGGTTGATATGTAGTAATCGTGTTCGTCAGAGAACATTCAATATCTTGGATCTTAATG
AATCAAAAAGAAACGATTCGGCCACTCAAGAATGACCAAAAATGTCTTCAAGTGGCCCGA
GACCAATGCTTTGCAGCAACCCTTTCATGGCGAAAGACGCCCATGAGAGGAGGGGCTCAT
GCATGTTTGAAGGTAGCTTTAACTTAAAGCCTCTCGGGGCCAATTTCTCCTCCGGAAATA
TGAAAACACCTTTGAATCTCTATGGGACCCCCCCTATAGGGGGCGGAATACCCAAAAGAG
GAGGGGGGCCGACAGGCCAACCTCTCCCCTGTCTGAGGGGGGGCGGGGGCCCACGTTCTG
AGCCACCCTNGGTCGGTCCACGAGGACAAACAAAAAACCCCTCTCTCTCTTT
GenBank Accession AL754894 [GenBank]
Graphic View Graphic view of gene At5g15320
Predicted Position of Insertion Chr5:4977253 - go to primer design
BLAST e Value 3e-112
Hit Clone Code (BAC ID) F8M21
Hit Gene Code At5g15320 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation ATP synthase E chain
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL754892 [GenBank] AL754893 [GenBank]

Gene hit At5g15340

 
Sequence (A. th genome BLAST matches underlined)
>40-K012296-022-055-H05-35St
TGGACGAAGGGATGACGCACAATCCCCTATCCTTCGAAGACCCTTCCTCTATATAAGGAA
GTTCATTTCATCTGACCCAGCAACCCCATGTCCTTGTTGAGCGAAACCCAAATCCTCCAG
CTTGGCACACACGCCAAACAAACAAACTACAGAAACATCATCAATCTCTACTCTTTTCCT
TCTCATTTCCACGAAGAGCTTCATCGAATTAACCAACAATCCATACCGAGAAAAAGAGGA
TAACAAAGTGGTCCAATCCACATTGTCTTTTTCTGAAAGAGGAATTTCGTCGAACAGTTT
CTGGGCAGTAACCATTTCACCAGAGGAAGCATAAAACTGAAATAGCGCATTGCTAAGATA
CGACCTGGGAGCTTTCTTCAATCCAGAAGTGGTTAAAACGGCGTGCAATTCCTTGCCGGG
ACGGAGAAACGAACGGTGAGCGCAATGTCGGAGAAGGAGACGAACTTTTTGGTAGGATAA
GCATTTCATAAGATTAAGCTCGTCCCTTTAGTCCTATAACTGATAGAATCTTAGAGCTAT
GGCGTTAGATCTCTGCCTTCGACGGTTCTAACTTCTCGTGAGTTCAATTTTCCCGGGAAA
CAAACAGAAAATCTGGGCTCTTAAATACACTTCACGCGCCTTGATGAGAAATTTAGAGCG
CGTGGGATAAATGTTTTTAATCTTTTGTCCAGTACATCATAAGTGACATAATAAAGGTTT
TTGGGTTTTGATCTGCAAGGATGCAATGATTCAATAGAAACTATGGGAT
GenBank Accession AL754891 [GenBank]
Graphic View Graphic view of gene At5g15340
Predicted Position of Insertion Chr5:4983733 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F8M21
Hit Gene Code At5g15340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Pentatricopeptide repeat (PPR) superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03