SimpleSearch - Line and FST details


Line specific information

 
Line ID 056C08
Vector Used pAC161
Line Availability only available from NASC (N405312)
Segregation Analysis 100:88:77
Confirmed for Hit At2g37240
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g37240

 
Sequence (A. th genome BLAST matches underlined)
>59-K016078-022-056-C08-8409
ATTGCTGATCCTGTAGATTATTACACGTGTCAGATGATGTAACCATGATCTCAGAGAAAA
AGTCACATGCCACGTCAGTTAACTTTAGGGCAAAATGGGAAAAGAATCTAAAGAGCATAT
GTTCGTGCACGTTCTTGTTTAGGGTAAGCTCAAAGCTCAAGCCGCTTCTATCTCTCTACA
TTTCTCTTTCTGCAATGGCGAGATTAGTGCGTGTGGCTATGGGATCCTCCCCTATAGTGA
GATGATAACCGATTCTACTCTACTTCAGCCGAAGCTATGGGATCCTCCCTATAGTGAGAG
GAGAAAAAGAAAGAGNAATTACCAATTTTTTTTCCATTCAAAAATGTAGATGTCCGCACC
GTTATAATAGAAGGGGGGGTTGGTAATCCGCACTTAACGGGAATAGGGGGGGCGGGGGGG
GGGACGATATCGGCGGAGGAAATGGGGGCATAGGCAGCGCAGAACGCGAAATGGGGGGAG
CCCGAGAGGGGGGTCACGCGCCGCCGAATACCCAGGGCCCCAAAAAGAGGAGAAACAACA
ATAAA
GenBank Accession BX649682 [GenBank]
Graphic View Graphic view of gene At2g37240
Predicted Position of Insertion Chr2:15641814 - go to primer design
BLAST e Value 2e-110
Hit Clone Code (BAC ID) F3G5
Hit Gene Code At2g37240 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Thioredoxin superfamily protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23