SimpleSearch - Line and FST details


Line specific information

 
Line ID 056C08
Vector Used pAC161
Line Availability only available from NASC (N405312)
Segregation Analysis 100:88:77
Confirmed for Hit At2g37240
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g37250

 
Sequence (A. th genome BLAST matches underlined)
>59-K016083-022-056-C08-8409
GATCCTGAAATTTCCCGGACATGAAGCCTTTACATTGAATAATTTTGTATAATACCGTCT
ATTAATGGGTGTCTTTAGATTTTTATAATATAAAGACACCCAGCCGATGGGATACTCCCT
ATAGCAGAGATTCGTGCACGTTCTTGTTTAGGGTAAGCTCAAAGCTCAAGCCGCTTCTAT
CTCTCTACATTTCTCTTTCTGCAATGGCGAGATTAGTGCGTGTGACTATGGGATCCTCCC
TATAGTGAGAATGATGGTTCTGGCCGCCTCCGAAGGCGGTCTTCTTCTGCTTACACCTAT
TCTGCGCACGAAAACCCCAGACTACTTCCCAAGAAACAGAGACAGCTTCATAGGGCTTTA
TCAGTGCTGTGGAGGAATTCCGTAATCTACAACTGCTTGACTATTTCCACGACCCTCTCT
TAGAGACAGTGTCCCCATCCTAACATCTTGCGTGCGGAGACCTACTATTCCAATTCGGGA
TTTCGCTACCTATAAGACCTGTATATAATCGGATCGCAGCTCGCCGGGACTTCTGGCGAC
GACTCGCCTGGCATAATGTCACCAGGATCTTTATTATCTACGGACTGCGCAGGCAGGAGA
CCCCATACATGGTGTGATACTCCCCAAGAAGACGTGTGTTTTTGGTAAACAGTCGCCCGG
GCCTGGTCACTGCGACCCCCTTTGTGAGGAGGCACCCCTTCTTCCGAAGTTACGGGGGCT
ATTTTGGCGAGTTCCTTAAAGAGAGTTGTCTCGCGCCCCTA
GenBank Accession BX649683 [GenBank]
Graphic View Graphic view of gene At2g37250
Predicted Position of Insertion Chr2:15641846 - go to primer design
BLAST e Value 6e-46
Hit Clone Code (BAC ID) F3G5
Hit Gene Code At2g37250 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation adenosine kinase
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit BX649683 [GenBank]


Last Updated on 31.08.2016 09:40