SimpleSearch - Line and FST details


Line specific information

 
Line ID 057A04
Vector Used pAC161
Line Availability only available from NASC (N405380)
Segregation Analysis 100:100:92
Confirmed for Hit At5g52600
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g52600

 
Sequence (A. th genome BLAST matches underlined)
>25-K016085-022-057-A04-8409
TGTCCTGTAGATTTCCCGGACTGAAGCCCTTTATCTTGTCACATTGTTAACGTCAAGATC
CTTGGCTCATGGACCTCATATCTACTATGGGATCCTCCCTAGTAATCAGACATACCTTTT
ATGTATCATATCTTCTTCCGGTTCCCTCGACCCTGCTCTTCTAGTATAGACTGTAATCTA
CTTCTCTTATGTACTACTCCTACCATTTATACTCTCTACCCTAACTTTGTGACCGCAGGT
GTTACCTACTCATCTATCGCTAAGACTGAGCGTTACTCCTATAATATCTCATATTGTAGC
GGACAATCTATCGTGGAATCATTCTATAGAAAGAGAGAACAGTGGTTTGCACTTTTCCGA
CAGTAACACTACTGTAAATTCGTGCAAACTATGGGATCCTCCCTATAGTGAG
GenBank Accession CR396060 [GenBank]
Graphic View Graphic view of gene At5g52600
Predicted Position of Insertion Chr5:21343824 - go to primer design
BLAST e Value 1e-25
Hit Clone Code (BAC ID) F6N7
Hit Gene Code At5g52600 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 82
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit CR396061 [GenBank] CR396060 [GenBank]


Last Updated on 31.08.2016 09:40