SimpleSearch - Line and FST details


Line specific information

 
Line ID 057B09
Vector Used pAC161
Line Availability only available from NASC (N405397)
Segregation Analysis 50:41:32
Confirmed for Hit At1g05830
Parent of DUPLO pair 2488
Parent of pair(s) none

Gene hit At1g05830

 
Sequence (A. th genome BLAST matches underlined)
>66-K016085-022-057-B09-8409
TGGGTGAAGGGATTAATGAATGTGGTACAGATATGTTTGGATTCTGGAAGNAAGAAGTGG
ATAAACTTATTAAGGTTTGTCTTCTTGAATCTGAAATTATATGTGGTGGCTTTAGTTTTG
TCTCCTTTTACTCCTTCATTCACTGAACTCTCAGGAGTCTTTGGTTAGGTTCTCCGTTGT
ACTAATTTCGGGACCCTGAAAACTTTGCAGTGCTCTACCCTTCTGCTTTGAAGTTAAAAC
GCATAATTAGGCATCTTTTATGTTTGGCGTGGAAGTTTAATATAATCACGCCCTATGGGA
TCCTCCCTATAGTGAG
GenBank Accession AL936577 [GenBank]
Graphic View Graphic view of gene At1g05830
Predicted Position of Insertion Chr1:1757208 - go to primer design
BLAST e Value 7e-129
Hit Clone Code (BAC ID) T20M3
Hit Gene Code At1g05830 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation trithorax-like protein 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL936576 [GenBank] AL936577 [GenBank]


Last Updated on 31.08.2016 09:40