SimpleSearch - Line and FST details


Line specific information

 
Line ID 058A08
Vector Used pAC161
Line Availability only available from NASC (N405480)
Segregation Analysis 100:100:76
Confirmed for Hit At5g51930
Parent of DUPLO pair none
Parent of pair(s) 566, 4664, 4667, 11260

Gene hit At5g51930

 
Sequence (A. th genome BLAST matches underlined)
>57-K016086-022-058-A08-8409
ACCCGGATACTTGTACTTGTATCACACTTTGGAATTTATCATTCTAATAATGGTGTTAAG
CCCTTTAACACACTTGTTCAAATCCTCTGGTTCTTGATAGTAGTTGAATGTCACTGAAGG
ATTATCCCTTGGGTTCGTGTTCCGTAGCTTCATATGTCCTTTTGAGGGCGGTCCATCGAC
TTTTTGAAAGATCAAACCCCCATTCATCCTCACTTCCAATTTAACATCAAAAGATTTTAA
AAGGACTGCAATGGATTGGGTCAGGATTTTCCTAGATGTAGTATGACTTGTCTGCATAAT
GCGTCATAGTTAGACAACATACAATCTCATAAGTCATAACTAAATAACCTTTAAATGTAT
TTATGTGATATACCTCGTTTAAAAGATTCAAAACACCATCGAAAAACCTACGAGTTATAT
CAAAAGAGAGACTCCAGCCACTTAGACCTTCAATGTAACTATCAAACTTTGTGATCCCAA
CAGCTTGTATGAGGGATAGTTCTACTGGTTGAGGAGAAGGAATGGCTACAAAGTTCATGG
GATTATCAGCCATCCCCTGCCCAACCATGGGGCTGATCTATGGGATCTCCCCTAATAATG
AGAACCACAGAGAACCACGTATTACCAATTTTTTTCTACTTCGAAAATGTAAAAGCCCCC
CCCCTTTATAAAAAAAGACCGCGCGACAATAAAAAACCAAACCAAAACTAAAAAGAAACA
AAAGGGTTCCCCCCATAACCCCCCTATATCGAATACAACCCACCAAAAATAGAAGAAATA
ATA
GenBank Accession BX890733 [GenBank]
Graphic View Graphic view of gene At5g51930
Predicted Position of Insertion Chr5:21103298 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MJM18
Hit Gene Code At5g51930 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Glucose-methanol-choline (GMC) oxidoreductase family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23