SimpleSearch - Line and FST details


Line specific information

 
Line ID 058C10
Vector Used pAC161
Line Availability only available from NASC (N405506)
Segregation Analysis 50:45:41
Confirmed for Hit At4g00300
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g00300

 
Sequence (A. th genome BLAST matches underlined)
>75-K016087-022-058-C10-8409
TATCCTGAAATTTCCCGNACATGAAGCCATTTACATTGAATATATCCTGCAACCACCACT
ATAAAAAGCCACCACTCTCTCTGCTTCTCTGCAACACATAACCCACTCACAGAAAAACCT
ATNGNATCCTCCCTATAGTGAGANNNTCNTCCTTGNTGGNNTATACGTACGCGTGATTTG
AACTGTGTATCCCCACGAGATTGACATTGTCCACTGATGACTCTTATCATAGCATACCGA
TTGTTGGACAAGACTCGCTGAATCGAGTTTCGCTGGGATCATTAGCTTCTTTAATGCGTT
GACTCGGTTTGTTTTTGGGAATATAGGATCCACTACGCCTATGGGATCCTCCCTATAGTG
AGAAAAAAACATAATCCCAATTCCCCGTTCTT
GenBank Accession AL936714 [GenBank]
Graphic View Graphic view of gene At4g00300
Predicted Position of Insertion Chr4:127867 - go to primer design
BLAST e Value 1e-96
Hit Clone Code (BAC ID) F5I10
Hit Gene Code At4g00300 [TAIR] [MIPS] [SIGnAL]
Gene Annotation fringe-related protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23