SimpleSearch - Line and FST details


Line specific information

 
Line ID 058C10
Vector Used pAC161
Line Availability only available from NASC (N405506)
Segregation Analysis 50:45:41
Confirmed for Hit At4g00295
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At4g00295

 
Sequence (A. th genome BLAST matches underlined)
>75-K016086-022-058-C10-8409
CGGTTTGTTTTTGGGAATATAGGATCCACTACGTCTATGGG
GenBank Accession AL936713 [GenBank]
Graphic View Graphic view of gene At4g00295
Predicted Position of Insertion Chr4:127876 - go to primer design
BLAST e Value 7e-12
Hit Clone Code (BAC ID) F5I10
Hit Gene Code At4g00295 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation fringe-like protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Other FSTs Supporting this Hit AL936713 [GenBank]


Last Updated on 31.08.2016 09:40