SimpleSearch - Line and FST details


Line specific information

 
Line ID 058D02
Vector Used pAC161
Line Availability only available from NASC (N405510)
Segregation Analysis 50:50:50
Confirmed for Hit At5g25420
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At5g25420

 
Sequence (A. th genome BLAST matches underlined)
>12-K016087-022-058-D02-8409
TATCCTGAAATTTCCCGGACTGAAGCCATTTACATTGAATATTAACCTCCTGTCAGACAC
TTTAAGCGTTCTCTTTCTCTCTTACTCTACTTTGATAACTTCTTTTTCTCCTTCTAACTT
TGGTTCTTGACATTTGCAGGTGCATGACAAGGAGGCAAAATGAAAGGCCCCGATCCGGAC
TGCCTAAAGTCCGGACGAGTTCTCTCGACCCAAGCCACTAAGTGACTCGGCCCTAACCGT
TTATGAGGTTCTTTCCTATGGGATCCTCCCCTATAGTGAGAGAAGCTATTGAGGTTGCAA
AATTGTATAAAGCTAAGTCCCGCAGAAGCTGCAATATATTAAATTTGATTTTGGTTTTAG
TAAAAAGTATAATACATATATTTATAGGAAATGTAATCTTAACACTTATAGAAATTACAA
GTGTGATGTGATGAAGCGACTTACACACAAAACACAAGACGATGCAATAAAGAGATGCCA
TGATTGGTAATGGTATGGACGCAAAAAAAGCTCCAAATTTTCCTGCATTTTGACCAAAAT
AAATAAGTTGCTAAACCAGTAAAAGATATTCATAACATCCTTTATACAATACAAATAGAA
AGATATAGGTTAAACAAAAAAAATATACCAAAAATGGAGAGAAAAAGCTGGAATGCTGCT
GATATTTGTATCCCCCTTCCAACTCCCACCTTAGTCATTGCTAAAAGTCCAACATTTTCT
CTGAATATACAGTTACCCCCATATTCAAACTATATCATTAGCCCTTTATTACTA
GenBank Accession AL936719 [GenBank]
Graphic View Graphic view of gene At5g25420
Predicted Position of Insertion Chr5:8838478 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F18G18
Hit Gene Code At5g25420 [TAIR] [MIPS] [SIGnAL]
Gene Annotation Xanthine/uracil/vitamin C permease
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details

Gene hit F1N21

 
Sequence (A. th genome BLAST matches underlined)
>12-K016086-022-058-D02-8409
TATCATGAGATTTCCCGGACATGAAGCATTTACAATTGATATGCACCTATGGGATCCTCT
CTACAGTAGAGATCTTTGCATTGTTTGTAAATAACTACATATTATTATCTTCGAAAATGA
ATTTCACATTTCAACAAAATAAAATATTTTCATGTTTCTACATGCATGCTATGGGATCCT
CCCTATAGTGAGACCTTTTTCCCCTGCTATGGGCTCCTCCTTAAAGGGAGTTTTCTAACA
GACTTCCTCTACTATTTCGGGCGTGGATGGACGAAAAAACTTTATCTGCGCAATCCTGCC
TTTAATACGTATTTTGGGTTGAACCAAGAAGCTTTGGTACAAGGGTAAAAAGAGGAAATT
TCTACTATTTGGGTTCAAGAAAAATTGGTCATTGAGGTCCAAACAATTTAACATAAATTT
GTTGGCCCTGAAAATTAATCTTTGGATCTATGAAGTTTTTAAGGCCACCTAAATTAAATA
TCGAATACTTTTGACATTTTCACCTCTCTAAAAAAATTTAACGGTAACCATAGTTAAAGC
GGATAAAAATGTTTATTGATTAACCTATTTTTATTTATCCTTAAAAATATACTCTATTG
GenBank Accession AL936718 [GenBank]
Graphic View Graphic view of sequence AL936718 of line 058D02
Predicted Position of Insertion Chr1:25203444 - go to primer design
BLAST e Value 3e-94
Hit Clone Code (BAC ID) F1N21
Insertion Classification Genome Hit
Confirmation Status unknown


Last Updated on 14.10.2014 10:23