SimpleSearch - Line and FST details


Line specific information

 
Line ID 058E06
Vector Used pAC161
Line Availability only available from NASC (N405526)
Segregation Analysis 100:100:77
Confirmed for Hit At3g48990
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At3g48990

 
Sequence (A. th genome BLAST matches underlined)
>84-K029207-022-058-E06C-3144
CCTTCCTCTATATAAGGATGTTCATTTCATTTGGAGTGGACAGGGTACCCGGGGATCAGA
TTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTATATTCAATTACTACAGTATCT
GTGGAAGCAAAAAATGGCTAAAAGATGATGCCACGTGTTATCATCGTAGCGGATTTTCTA
TTGATCGTGTGGTCATAATGTTTTCATTTTTAATTATTTTGTTAACGGTGGGAGTCGCTG
ATATATATCCTTACGATTAGACCGACGTTTCGGTTTTTGAAGAGGTGGTTTTTTTAATTT
CGATTCCGGTACAAACACTGAACCGAAACGGCTAGTTAATTAACTTTTGAAAATATTTTT
TTTCGGCAAGCATGCGATAGTAATTTACGGTTTATGAATTATTTCATAGGAATTTGAAAT
AGTTTGTGTATGTATTATCAAACAAAAGAATAGTTTCATTAAAAAAATAGCCTATGAGTG
TTTAATCACTTTTAGGGCCTTTGCACATGTGTCTTTGACTAGGATTATCACGTTTCGAAG
AT
GenBank Accession HG968674 [GenBank]
Graphic View Graphic view of gene At3g48990
Predicted Position of Insertion Chr3:18161386 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T2J13
Hit Gene Code At3g48990 [TAIR] [MIPS] [SIGnAL]
Gene Annotation AMP-dependent synthetase and ligase family protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL936740 [GenBank] AL936739 [GenBank]


Last Updated on 14.10.2014 10:23