SimpleSearch - Line and FST details


Line specific information

 
Line ID 058G08
Vector Used pAC161
Line Availability only available from NASC (N405552)
Segregation Analysis 50:47:47
Confirmed for Hit At5g59730
Parent of DUPLO pair none
Parent of pair(s) 2175, 4887, 91829

Gene hit At5g59730

 
Sequence (A. th genome BLAST matches underlined)
>63-K016087-022-058-G08-8409
TGTCCTGTAGATTTCCCGGACTGAAGCCTTTACATTGAATATATCCTGAACAGCTGGAGT
TTCTCCGGACATGAAGCCATTTACTCATTTCTCGACGACTTCCTCTTCTCCACCAACAGT
CGTCGTGAAGCAGAGGAGTTTGTTACAGCCGTTAGACATCTACAAAGCACGATGCATCGT
TTGGTTTCCGTTAACCCTTCCTCGGAGAAGCTAATCTACGCACAGAATCTAATGCAATCG
GCGATGAAGCTTCTCGAATCAGAGTTTCATCGTGTTTTAAAAGCGAACCGTGAGTATTTA
GATCCTGAATGTGTCTCTGTACGTTCTTACAGATCATCGAGATTCAGTACTTCGACTACG
ACTATGGGATCCTCCCTTATAGTGAG
GenBank Accession AL936776 [GenBank]
Graphic View Graphic view of gene At5g59730
Predicted Position of Insertion Chr5:24065895 - go to primer design
BLAST e Value 4e-152
Hit Clone Code (BAC ID) MTH12
Hit Gene Code At5g59730 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation exocyst subunit exo70 family protein H7
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit HG968675 [GenBank] AL936775 [GenBank]


Last Updated on 07.07.2016 14:03