SimpleSearch - Line and FST details


Line specific information

 
Line ID 059H06
Vector Used pAC161
Line Availability only available from NASC (N405658)
Segregation Analysis 150:148:138
Confirmed for Hit At4g21200
Parent of DUPLO pair 12881
Parent of pair(s) none

Gene hit At4g21200

 
Sequence (A. th genome BLAST matches underlined)
>17-K118465-0022-059-H06C-35St
ACCTTTCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAG
ATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTGAGAACGCCAACTATGAAAAG
TAACAACGGTATGTGGTCACACATACACAAACACGCACAGAAGCTGAAACAATGCATAAA
GATGTGTAAGACAACCACATGCATGCAAATACATATGTACATATAAGAATGTGTACAGAT
TCCAGCACACATTAGTACACACTGATCACAAGATAATTTATATACGTGTGTATTTATATA
TAGCTAGCTAGCCTGGCATGTCCGAGTACTTCTTCTTCCCTTCCATTATCCCTCATTTGC
CAAACAGACAGTTTTCTCGTGACTCTTCCTTTCTTTTCTCACCATATAGTACTGTAGTTA
TGTATTATACACAAATAGTGTGTACTATATGTTTCTAGATCGTACCTAGCTTGTTTTTAG
AGGTTCTGAGTAAACTAAAATTTTATTTGAGAAAATTCTTTTCTTTTTTTTTGGTAAAGG
TTATTCAAAAATTCTTAATTGAACACACATATGAAAAAAGTTATGATACATAATCTCTTT
TGGACAAAAAAAAAAGAGATTTACCTAAAATTTTGTAAATGTAAAAGGGTTAGTTTGATT
CCAGTTATGTATAGGCGTGTTAATTGTTTGAAAGTTTTCAAATATAAACTTTCGCAAACT
CGAAGTATAATGTTAATATATGGTTTTGAAAAGCAACTAAGGTCTCCTAATGAGTTGGTT
GATGGGTTTTTTTTTTCGAACCAAGAATTGGGTAAAGGGTTTTCAATAATTT
GenBank Accession HG968676 [GenBank]
Graphic View Graphic view of gene At4g21200
Predicted Position of Insertion Chr4:11304898 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F7J7
Hit Gene Code At4g21200 [TAIR] [MIPS] [SIGnAL]
Gene Annotation gibberellin 2-oxidase 8
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23