SimpleSearch - Line and FST details


Line specific information

 
Line ID 061A12
Vector Used pAC161
Line Availability only available from NASC (N405772)
Segregation Analysis 50:49:42
Confirmed for Hit At1g06160
Parent of DUPLO pair none
Parent of pair(s) 6805

Gene hit At1g06160

 
Sequence (A. th genome BLAST matches underlined)
>89-K016088-022-061-A12-8409
TTTCCCGGACTGAAGCCTTTACATTCTCCATCTTCCGGAGAGATTCTTCAACGACATCCG
CGGGGAAATTGAGTACTGCGAGGCTGCCTTTCAAAGCGAAAGCCGCCTGATCATAAGCGA
GAGCCGCCGCCTCCGCGGTGTCGAATGTCCCAAGCCACACTCTTATCCCTTTCCTCGTTG
AGTCTCTTATCTCGGCCGCGAATTTCCCCCACGGCCGTTTCCTCACTCCTCTGTATGACT
TCTCCTCCTCCTCGGCCGCCACGGTGGCTTCTTTTCCTTCTTCTTTTATGATTGATGATT
CAAATGCAAAGAAGTCATCACAGTAGTTATCAGTAGGGCTATGGGATC
GenBank Accession AL936807 [GenBank]
Graphic View Graphic view of gene At1g06160
Predicted Position of Insertion Chr1:1883503 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F9P14
Hit Gene Code At1g06160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation octadecanoid-responsive AP2/ERF 59
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL936808 [GenBank]


Last Updated on 31.08.2016 09:40