SimpleSearch - Line and FST details


Line specific information

 
Line ID 061C04
Vector Used pAC161
Line Availability only available from NASC (N405788)
Segregation Analysis 100:97:94
Confirmed for Hit At5g66210
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g05340

 
Sequence (A. th genome BLAST matches underlined)
>27-K016089-022-061-C04-8409
GAAGTTTGTAGCAGCAGCTCTACATGTTCATCAACTATGGGATCCTCCCTATAGTGAGTA
TGAAAGAAAAAGAANCNCTNGGTCATAATGTTTACACTATGGGATCCTCCCTATAGCGAG
AGAGAAAACAAGNACCATTTGCAGCTTGCTTAAATACATGACCTCACATCACGAACACAA
CGAACAAGATCGCAAAAACCTCGCGGCTCTATAACCCGTGAAGCACACTTCGGAAATTCA
AACGAATTAATCACTGAAGTAGAAGGATGAGGAGGCGACGAACAATACCATTGGTGATCA
ATACGAGGACGGTGCAGGAGAAATGCAGTGGTTGGTTTGGGAACATATCACGGAATCTAT
AGATTCTCTCTCTGGTCTATGGCGGGGTCTATCGACACTATGGGATCCTCCCCTATAGGA
GACTCGGAAATTCTCAAAAGCAACCCAATACCAAATACACGCGAAAACCCATACAAACAA
CACCCACAGACACAGAAACACACCGATAAACAACCTCCCCCCCGAACAGCCCTCCTATGT
ATCGCGTAGGCCAACCCCCAATTACAATAGCATGCCGTCACAACCCGCGCAAACGGAAGC
GCCCCACATCCCCCACAAAGAACCCCCCGAACCGCCCAAAGCCACGCAAACCGACCCGCA
AAACCCCGCCCCGAGGGGAAAACCCCCCGGCGTGCCTATAATACAAACGCCACCCCGCCA
ATCACCGTACCGAAAACCGAAAACCATAGTAAA
GenBank Accession BX942863 [GenBank]
Graphic View Graphic view of gene At2g05340
Predicted Position of Insertion Chr2:1947527 - go to primer design
BLAST e Value 2e-86
Hit Clone Code (BAC ID) F5G3
Hit Gene Code At2g05340 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation transposable element gene
Insertion Classification TS2TE
Confirmation Status unknown

Gene hit At5g66210

Sequence (A. th genome BLAST matches underlined)
>27-K016089-022-061-C04-8409
GAAGTTTGTAGCAGCAGCTCTACATGTTCATCAACTATGGGATCCTCCCTATAGTGAGTA
TGAAAGAAAAAGAANCNCTNGGTCATAATGTTTACACTATGGGATCCTCCCTATAGCGAG
AGAGAAAACAAGNACCATTTGCAGCTTGCTTAAATACATGACCTCACATCACGAACACAA
CGAACAAGATCGCAAAAACCTCGCGGCTCTATAACCCGTGAAGCACACTTCGGAAATTCA
AACGAATTAATCACTGAAGTAGAAGGATGAGGAGGCGACGAACAATACCATTGGTGATCA
ATACGAGGACGGTGCAGGAGAAATGCAGTGGTTGGTTTGGGAACATATCACGGAATCTAT
AGATTCTCTCTCTGGTCTATGGCGGGGTCTATCGACACTATGGGATCCTCCCCTATAGGA
GACTCGGAAATTCTCAAAAGCAACCCAATACCAAATACACGCGAAAACCCATACAAACAA
CACCCACAGACACAGAAACACACCGATAAACAACCTCCCCCCCGAACAGCCCTCCTATGT
ATCGCGTAGGCCAACCCCCAATTACAATAGCATGCCGTCACAACCCGCGCAAACGGAAGC
GCCCCACATCCCCCACAAAGAACCCCCCGAACCGCCCAAAGCCACGCAAACCGACCCGCA
AAACCCCGCCCCGAGGGGAAAACCCCCCGGCGTGCCTATAATACAAACGCCACCCCGCCA
ATCACCGTACCGAAAACCGAAAACCATAGTAAA
GenBank Accession BX942863 [GenBank]
Graphic View Graphic view of gene At5g66210
Predicted Position of Insertion Chr5:26457083 - go to primer design
BLAST e Value 1e-10
Hit Clone Code (BAC ID) K2A18
Hit Gene Code At5g66210 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation calcium-dependent protein kinase 28
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Related paper(s) [Matschi et al. 2013, cpk28-2]

Gene hit At5g24270

 
Sequence (A. th genome BLAST matches underlined)
>27-K016088-022-061-C04-8409
GATCCTGTAGATTTCCCGGACATGAAGCCATTTACAATTGATGATATCCTGCAATTGAAT
ATTAATTCCAATACTGAAGATGATATGATAAAGAATTTATAAGGAAATGGTGGTATATAT
TTGCAGGCTTTCGTGCAAGCAGACCGCAAAAACGACGGAAAAATCGATATAGATGAATGG
AAAGACTTTGTATCCTTGAATCCATCGCTCATCAAGAACATGACTTTGCCATATCTAAAG
TGAGTTCATAATTTACACCGTGACCAACTTTGATCCAAACCAACTGCTTTGATTGTTGCA
TTGAATCAAATTGACTAATCAGAAGATTCTTGGTAAATGTAGGGACATAAATAGGACGTT
TCCAAGTTTCGTTTCATCTTGTGAAGAGGAAGAAATGGAATTGCAAAACGTATCTTCCTA
ATATAAGCCATGCAAGGAAAGATAAATATACATAAAACGAATATTTTTGTACAATATCTT
AAAAGAGGAAGATAGAGATGTAAGCTATGGACTCCCCCCATAAANNGGAGAGAANNCCNN
NNACCCCCAACCCCACCACGGCACAAANGGCCCCCCAGCGTAAAGAGACCGACCGGGGNA
AAACGGGNGCCCNCCAATCAAAGGGACCCATGGGAGGGAGGCACTCCAAAAAGAGGGCAA
ACCAAAAAGGGGGGAACGCGCCCACTGTGGGAGCCTCCGGTATACTGAAAGCAAAACAAA
CGGGGAAACAAGAGCCTTTGGTTTC
GenBank Accession AL936823 [GenBank]
Graphic View Graphic view of gene At5g24270
Predicted Position of Insertion Chr5:8239143 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) MOP9
Hit Gene Code At5g24270 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Calcium-binding EF-hand family protein
Insertion Classification CDSi
Confirmation Status unknown


Last Updated on 07.07.2016 14:03