SimpleSearch - Line and FST details


Line specific information

 
Line ID 061D02
Vector Used pAC161
Line Availability only available from NASC (N405798)
Segregation Analysis 50:49:45
Confirmed for Hit At2g39700
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g39700

 
Sequence (A. th genome BLAST matches underlined)
>12-K016088-022-061-D02-8409
TGATCTGAAATTTCCCGGACTGAAGCCATTTACATTGAATATATGAAGCAAGTTGCCACG
GTAGTGATCAGAACCAAGTTGAATTAACGGTGACCGTTGATTGTGAACACTTATGCCTCC
TCTCTTTCTACATGGAACCCTACTAACAAAACCAACATTTCACACGCGTTTAGTCACTCA
CTTATATGTCCATTTATTGACTAATTTGTATGCTATGGGAGGCTGGCTAAAACTGTGTCT
CCCCACGATCTGCGTGAGTGGGGGTCCCTCTTTGGGACCACTGTGGGAAGAGGCATCATT
CTTCGATCGGTTTCTCATATATCGCGATGATGGCAGACACAAGTATCTGCTTGCTGTATC
GACTATCCTAACGAGAAATGACTATATAGCTGGGCAATGGAATCCGAGGAGGTTTCCGGA
TTTAACCCTTTGATGAAAAGTCTCAATTGCCCTTTGGTCTTCTGAGACTGTATCTTTGAT
ATTTTTGGAGTAGACAAGCGTGTCGTGCTCCACCATGTTGACGAAGATTTTCTTCTTGTC
ATTGAGTCGTAAGAGACTCTGTATGAACTGTTCGCCAGTCTTTACGGCGAGTTCTGTTAG
GTCCTCTATTTGAATCTTTGACTCCATGGGAATTGGGGATCCTCTATGGGAT
GenBank Accession FR802005 [GenBank]
Graphic View Graphic view of gene At2g39700
Predicted Position of Insertion Chr2:16544472 - go to primer design
BLAST e Value 2e-64
Hit Clone Code (BAC ID) F17A14
Hit Gene Code At2g39700 [TAIR] [MIPS] [SIGnAL]
Gene Annotation expansin A4
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23