SimpleSearch - Line and FST details


Line specific information

 
Line ID 062C10
Vector Used pAC161
Line Availability only available from NASC (N405890)
Segregation Analysis 100:98:74
Confirmed for Hit At4g26640
Parent of DUPLO pair none
Parent of pair(s) 80957

Gene hit At4g10740

 
Sequence (A. th genome BLAST matches underlined)
>75-K016100-022-062-C10-8409
TGTCCTGTAGATTTCGTGATTGCTGCTATGATTTTCCACTCTAAAATGAGAGGGCGTTGT
TGCCTTCATTTGTAGGTGTAACAGATTATGAAACATGCCATGGTCTCTCCAGGGTTTTGC
TCGCTCGCGATGAGAGAGGTGTCTGTTTAGGACAAAATTGTGCACACGGCCGAGGAGCCT
TGTAAAACATGATAAACGCCGTTGAACGGATATTGTTTCCGCCGGTGTGCGTAAGGTCCA
TCTTCCGCAACGAGTATACTAACTGATGGAAACCTTAATGACCTATGGGATTCTCTACTG
TAATGCGACCTGTTCTTAGGCTAATTTCGCATCGGAGAGCATAGTTATGAACATCTCTGC
CTTCCCTTTCACTTGTACGGCGATACTATCTGCCTTGGATCCGCCTGGTCTGCCCCTAAT
ACGGATTCTGAGCTGGGTCCTAACATCTCGTCTCTTACGATGCCTAATACTGAGCCCTCG
CTATGACATACTTAAGACCTCTCGCCTTGTTATCAACCCTGTAGGCAGGTAAGTTTACCT
ATGGGATCCTGCCTATAGTGAAGANCCANACCCCTCTTTTTTTCCCCCCCCGTGCCTTTC
TTTCTTTTGCA
GenBank Accession FR802018 [GenBank]
Graphic View Graphic view of gene At4g10740
Predicted Position of Insertion Chr4:6617680 - go to primer design
BLAST e Value 7e-21
Hit Clone Code (BAC ID) T12H20
Hit Gene Code At4g10740 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation F-box and associated interaction domains-containing protein
Insertion Classification CDSi
Confirmation Status unknown

Gene hit At4g26640

 
Sequence (A. th genome BLAST matches underlined)
>07-K029297-022-062-C10C-3144
CTATCCTTCGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGCAGAGGACAGGG
TACCCGGGGATCAGACCAGATGAAACAGACACCATCAGCCTCAATCTTGGTGTTGGAATC
TCATCTGATGGACCTAACCACGCTTCCAACGAACATCAGCACCAGAATCAACAACTTGTC
AACCAAACTCACCCAAATGGAGTCAATTTCAGGTTTGTTCATGCTAGTCCCATGTCATCC
TACTATGCTAGCTTAAATAGCGGTATGAATCAGTACGGCCAGAGAGAAACAAAGAACGAG
ACTCAAAATGGTGACATCTCGTCCTTGAACAATTCATCTTACCCATATCCGCCCAACATG
GGGAGAGTACAATCGGGTCCGTAAAACAAAAAGTAAGCAACATTATGTACGGGATCTTCT
TAGGTNAAGGAATG
GenBank Accession HG968686 [GenBank]
Graphic View Graphic view of gene At4g26640
Predicted Position of Insertion Chr4:13437611 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) T15N24
Hit Gene Code At4g26640 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation WRKY family transcription factor family protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03