SimpleSearch - Line and FST details


Line specific information

 
Line ID 063B01
Vector Used pAC161
Line Availability only available from NASC (N405965)
Segregation Analysis 50:41:32
Confirmed for Hit At3g62860
Parent of DUPLO pair none
Parent of pair(s) 9706, 96652, 96662, 96664, 96666

Gene hit F20H23

 
Sequence (A. th genome BLAST matches underlined)
>02-K016169-022-063-B01-8409
TTTCCCGGACTGAAGCCTTTACAGAGACGAGGGAAGAAGAAGAGATTAAAGAAACAAGTT
TCAGTATATCTCCACGATTAAGTTTCCGATGGTTTCGATTAACCCTATTTTTGTGAGCTC
AAAGCTGGTTTTGCATCCTCTACCGTCTCGCCTTCATTTGCTTCTGTTGATCAATAATCA
TATGCATTTTTTTGATGTGAACTTTGATTTAGTACAATTTCTCCCATATAAGCCTAATCC
AGTTCTTACAATTCACAAAGCATTAATTCTATCTACGACTAAGACAGCTGAATCTTAAGA
ACAAATGGCTTAGTATTGCTATCATTGTTGATGCACGCTTTGATTAATTGAGATTTAGTG
CTTGGCCTTTACTACAGTGGCTCTATAATCTCTTACCATGTTTTCAGTACAAGTTTGCAG
TTTGGTACACACGACGAACACCAGGAGTTCGGAGCCAGACAGTCTTATGAGGATGACATT
CAGCAAAATCGTGGAGTTCAGCACAGTAAGTTGACATTTATACTTGAGACTGTATCTAAA
TCCTTGCTGCTGTCACCTGTTTGTCTTCATCTCCACTATTTTACGGCTATGGGATCTCCC
CCC
GenBank Accession AL937008 [GenBank]
Graphic View Graphic view of sequence AL937008 of line 063B01
Predicted Position of Insertion Chr3:991605 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F20H23
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At3g62860

 
Sequence (A. th genome BLAST matches underlined)
>02-K016170-022-063-B01-8409
GATCCTGTAGATTTCCCGGACATGAAGCCATTTACAATTGAATATATGAGAGCATTAAAT
ACCTCTCATGAAGCTACTGCACTCCATTCCATAACCTGCACATTGACCAATTCTTATTAT
TATTAGGAGATTTTTTTGTTTTGTGAATCAAGTAAATCAGAAAAAAGCAAATAAAATTGG
ATTAATAAAACTTCTATTAGTATAGTTGGTGTTACCATGGCAGAGGAAGACTATGGGATC
CTCCCCTATAGTGAGAGTCAAACAACTATCCACGTATGTGATCCTTACTACAATGAGAGT
GATGTAGAACAAAACATCCAGGACTGGAACTGATGGTATGGGTTGCGCGAACGCTCACCC
CCTCTGTCACAAATGCTGACGCATGACCTTCCTCAAGGCAACACCTTAAACATAGCATCC
TTCAGGCATGCGCCATGTAAGTCACTAGCCTA
GenBank Accession AL937009 [GenBank]
Graphic View Graphic view of gene At3g62860
Predicted Position of Insertion Chr3:23241721 - go to primer design
BLAST e Value 4e-87
Hit Clone Code (BAC ID) F26K9
Hit Gene Code At3g62860 [TAIR] [MIPS] [SIGnAL]
Gene Annotation alpha/beta-Hydrolases superfamily protein
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23