SimpleSearch - Line and FST details


Line specific information

 
Line ID 063D01
Vector Used pAC161
Line Availability only available from NASC (N405989)
Segregation Analysis 60:45:32
Confirmed for Hit At2g28850
Parent of DUPLO pair none
Parent of pair(s) 93829, 93830, 93832

Gene hit At2g28850

 
Sequence (A. th genome BLAST matches underlined)
>04-K016169-022-063-D01-8409
GATCCTGTAGATTTCCCGGACATGAAGCCAGTTTTCTATTTTGTCTTCTCCGTCCTTACC
GTGTGTTCTGAAAACTGAAAAAGAACCAAAACGAAAATCTAAAAAAACCCTTGAAAAATC
TATTTTTTATTGACTGGTTATTGTTTCAAATGAAAGCTTGACCTCTCTCTTATTGATCAA
TTTTCGCTTCTTCAATTAAACCATATTTGTTTTTCCCTTTCAAGCATTTTGATTCTCTAT
GGGATCCTCCCTATAGTGAGAACAATTGNACCTTTTGGGATTGTGTACGATTCCGTGAGA
CGGAAGTCACTAACAGCAACATGTGGGACCATACTTGCTGGTGGTCGGTATCTTAAGACC
TCACGCGCCACAGCCCGAATGTACTTCATCTCCGCGAGCTGATCGGCTGTGATCGACTCC
TTGGACTCACGCGACCAAAATCTTGCAACGTCCTCCCTCACTCTTCTTAGCACTTCTGGC
TCGGACTCAAGCAGCATCACTGCCCAGAGGAGTGATGACGTAGACGCGTACTCGTGAGGC
AAATAGAAAATCAACCAGCCCACAACTAATCTCTTTGTCTTTGGAGTGCAGCGGTGGACG
ACTCTCAGCTACCATCGAATGCTTCCGAAATTCACTAAACCTGGTGGATCCTCTCTGGCG
GGCATCTTTTC
GenBank Accession AL937034 [GenBank]
Graphic View Graphic view of gene At2g28850
Predicted Position of Insertion Chr2:12383596 - go to primer design
BLAST e Value 5e-176
Hit Clone Code (BAC ID) F8N16
Hit Gene Code At2g28850 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 710, subfamily A, polypeptide 3
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL937034 [GenBank]


Last Updated on 31.08.2016 09:40