SimpleSearch - Line and FST details


Line specific information

 
Line ID 065B12
Vector Used pAC161
Line Availability only available from NASC (N406168)
Segregation Analysis 50:48:35
Confirmed for Hit At3g09050
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit MIF21

 
Sequence (A. th genome BLAST matches underlined)
>90-011765-strizhov-B12-35St
AACTATGGGCGTAAGGGACGACGCTACAATCCACTATCCTTCGCAAGACCCTTCCTCTAT
ATAAGGAAGTTCATTTCATTTGGAGAGGACAGGGTACCCGGGGATCAGATTGTCGTTTCC
CGCCTTCGGTTTAAACTATCAGTGTCCATACCGACCAAATGCCGTTTTCTCTCATTTGGT
ACCCTGCAAAGCCACAGCAAAGACTACTGTTGTGATCGGACTTTCATGCCTTAAAGCATC
TAAAAGAAGACGCTTTTGAGAATCCACAATCGGACAAGCTCCGCTTGAGCCTTGTAGAGC
GCGAGTACGGCTCTTTGTCTACACGCGAGCGCGTGACTCCATACTCATAAAAATATCCTT
AGGGTCCTTAGAACATGGGTTCTTTAGAACTTTTTACCCAATGTTTCTATGGGATCCTCC
CTATAGTGAGTCGTATCACTC
GenBank Accession FR802090 [GenBank]
Graphic View Graphic view of sequence FR802090 of line 065B12
Predicted Position of Insertion Chr5:19564044 - go to primer design
BLAST e Value 1e-81
Hit Clone Code (BAC ID) MIF21
Insertion Classification Genome Hit
Confirmation Status unknown

Gene hit At3g09050

 
Sequence (A. th genome BLAST matches underlined)
>90-011560-strizhov-B12-oriL
ATGATCCATGTAGCATTTCCCGGACATGAAAGCCTTTACAATTGAATAATAGGCGGCCTG
TCCATGTAAATGGCTACATTGCTAATCTGGCCAATTTATAAAGAAATCTATGCGTGGAAG
TCTGACTTTATTGTAATCAAGAAAAACTGAACCCAGTCTATATTACTGTCTCAAATATAA
GGTCTTTTATGCAAATACTTTAAAACTCAAAACTGGTTTTGGATAATGCGTAAACTAAAT
TAAAAAACAAGAGGTGGGTTACTCTAAAACGAGCCTTCTTCTTCTTGGTTGAAAAAAACA
TAGAAGATGATGAACACACTTTATGCATTTAACACAACCTTAACACCAAACTTTCATGTT
CTTTGTAATGCCTCGAGACATTCTCTTTACCGACCCCAATTTCTCTGTCTCTCCAAATCG
GGAGACGGAACTTCAGATTCTGATTCTGATCCCGACCCTNCAAAACCCTAAGGCGATACT
CTCATGCAAGAACTCTTATCTATGGGATCCTCCCTATAGAGAGTC
GenBank Accession AL755058 [GenBank]
Graphic View Graphic view of gene At3g09050
Predicted Position of Insertion Chr3:2764612 - go to primer design
BLAST e Value 1e-158
Hit Clone Code (BAC ID) MZB10
Hit Gene Code At3g09050 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation unknown protein
Insertion Classification Promoter
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03