SimpleSearch - Line and FST details


Line specific information

 
Line ID 065E02
Vector Used pAC161
Line Availability only available from NASC (N406194)
Segregation Analysis 50:50:35
Confirmed for Hit At1g03490
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g03490

 
Sequence (A. th genome BLAST matches underlined)
>37-K032925-022-065-E02C-3144
TCCACTATCCTTCGCAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGAC
AGGGTACCCGGGGATCAGATTGTCGTTTCCCGCCTTCGGTTTAAACTATCAGTGTTTAAG
GGACTGATTAATACTCCATCTTCTGTCAATCGGTCTTGACAAGCTTTCCATGCACTCTCC
TGTGGTACGTGAAAGACTGCTCGTAACCCATCACCCTTTTGCATGTGTCCGTCCTTGATC
TCTTTTTTCCCATCGTTGCTTCTCCAAGTGCCGCCTTCGCTTCCTCCTCTTGCGGCTACC
TTCCGGTGTACGCTTAATATCTTGCCACCTCGTTCAGTAAGCGGAACAAAGTAGTACCAC
TCGTTGTTATTGAACAAAGGATTGTTTACGTGAGGAAGAAGCCAAGGGTAGTCTTGGTGG
ATGTCCATAGTTGTTATGAAACTGCTCTGATTTCTCTCCACCTTGTTTCAAAGATAAA
GenBank Accession HG968689 [GenBank]
Graphic View Graphic view of gene At1g03490
Predicted Position of Insertion Chr1:872280 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F21B7
Hit Gene Code At1g03490 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation NAC domain containing protein 6
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details
Other FSTs Supporting this Hit AL755083 [GenBank]


Last Updated on 07.07.2016 14:03