SimpleSearch - Line and FST details


Line specific information

 
Line ID 065G03
Vector Used pAC161
Line Availability only available from NASC (N406219)
Segregation Analysis 50:50:35
Confirmed for Hit At1g07160
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At1g07160

 
Sequence (A. th genome BLAST matches underlined)
>23-011560-strizhov-G3-oriL
CTGATCCATGTAGCATTTCCCGGACATGAAAGCCTTTACAATTGAAAGTAGACTGTGAGA
ACTGGTACCACTCAATACTTAATATATTACTACTGCTCTTATGAAATATTGAAGGAACGA
CTTAAATGTGTGAGCTATGGGATCCTACTCGCTAATGAGACGTATTACTTAAAATGTAAG
AAATTAAGAATGACTTCAGACTCTAACGTTGTTATTCTGTCTCTACATTTCTCCTATGGT
CAGAAGAGGTGGCACAACTGAATCAACATCACACTAATATCGTCCAAGGAGCCTCGTGAT
ACAGAGAGGTCAACGAGCTTCTTGCAAGCCAGCAATGGCTTCCGTTTCTGATCGGTCCCT
TTGCAAAATGGTCGAGCTATGTCTACTGCCTCCTGATTACTAACCTTGTCCCATAGACCA
TCTGATGCTAAGATCAAGAACTCGTGTTGGGGATTGATTCGGAGAATATTTATCTCTGGT
TCAGATATTATCCATTGTTTGAGATGAGCATCTCCTATTCCTCTA
GenBank Accession CR356260 [GenBank]
Graphic View Graphic view of gene At1g07160
Predicted Position of Insertion Chr1:2197974 - go to primer design
BLAST e Value 0.0
Hit Clone Code (BAC ID) F10K1
Hit Gene Code At1g07160 [Araport] [TAIR] [MIPS] [SIGnAL]
Gene Annotation Protein phosphatase 2C family protein
Insertion Classification TS2TE (3')
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 07.07.2016 14:03