SimpleSearch - Line and FST details


Line specific information

 
Line ID 066E01
Vector Used pAC161
Line Availability only available from NASC (N406289)
Segregation Analysis 100:71:64
Confirmed for Hit At2g34490
Parent of DUPLO pair none
Parent of pair(s) none

Gene hit At2g34490

 
Sequence (A. th genome BLAST matches underlined)
>05-011694-strizhov-E1-oriL
NTTTGATCCATGTAGAATTTCCCGGACATGAGAGCCTGTACACTAGGAGGAACCTCTCGC
TATGGAGAGATCGCATTACTCTTGTCTCACTAAACCGGGCCGGATCGAACCGGTTCGGTT
CAGTAAACCCTTGACACGAGGCGTCGAAAACCGAGGGAAACACTATTGTACCTTTTGGGA
TAGTGGACGATTCTGTAAGAGGGAAATCATTAGTAGCAATGTGTGGGACCATAGTTGCCG
GTGGTCGATATCTAACCACCTCACGTGCCACAGCGCGAGTATACTTCATCTCCGCGAGCT
GATCGGCCGTGATCATATGGCCAGACTGAGGTGACCAAATCTTGGCCACTTCCTCCCTCA
CTTTGCTCAGCACTTTCGGATGAGATTCTATGGGATCCTCCCTATAGGGAGTCGTTTTAC
TCAGGACNGNATCTTTGATATTTTTGGAGTAAACAAGCGTGTCGTGCTCCACCATGTTGA
CGAAGATTTTCTTTTTGTCTTTGAGTCGCCAGAAACTCTGTATAAACTGGCTACCAGTCT
TTA
GenBank Accession BX890735 [GenBank]
Graphic View Graphic view of gene At2g34490
Predicted Position of Insertion Chr2:14536096 - go to primer design
BLAST e Value 7e-163
Hit Clone Code (BAC ID) F13P17
Hit Gene Code At2g34490 [TAIR] [MIPS] [SIGnAL]
Gene Annotation cytochrome P450, family 710, subfamily A, polypeptide 2
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23