SimpleSearch - Line and FST details


Line specific information

 
Line ID 067H03
Vector Used pAC161
Line Availability only available from NASC (N406423)
Segregation Analysis 100:98:73
Confirmed for Hit At2g31180
Parent of DUPLO pair none
Parent of pair(s) 3178, 3228

Gene hit At2g31180

 
Sequence (A. th genome BLAST matches underlined)
>24-011693-strizhov-H3-oriL
TTGATCCATGTAGAATTTCCCGGCACTGAGAGCATTTACAGATTGAATATATCCCTGGCC
GGAAACACAAAATACGCTCGACGGCGTTAACAGCAAACCTCCTATAGACCACGAAGGATC
TGTGATAGTCTGACACAGCCTCTTTACAACAATTTTCTAATAGTATTACAACATTTGATA
TTTCAAATGATAACAAGGACGATATTATGTCGTATGGGATCCTCCCTATAGTGAGTCGTA
TTACTCAGNNNNTNNNNNNNNNNNCNTNNCTNTNCTTATANTCTNATTNTAATAGGAAAA
AGGAACATTGAGAATAGTTTAGTTTGAATACCACTAAAAATGAATTGTTATTAATATA
GenBank Accession CR934527 [GenBank]
Graphic View Graphic view of gene At2g31180
Predicted Position of Insertion Chr2:13287192 - go to primer design
BLAST e Value 2e-45
Hit Clone Code (BAC ID) T16B12
Hit Gene Code At2g31180 [TAIR] [MIPS] [SIGnAL]
Gene Annotation myb domain protein 14
Insertion Classification CDSi
Confirmation Status confirmed, show confirmation sequences
Primer and wt-amplicons show primer details


Last Updated on 14.10.2014 10:23